Stem-loop sequence hsa-mir-518a-2

AccessionMI0003173 (change log)
Symbol HGNC:MIR518A2
DescriptionHomo sapiens miR-518a-2 stem-loop
Gene family MIPF0000020; mir-515
Literature search

9 open access papers mention hsa-mir-518a-2
(13 sentences)

Stem-loop
                g   -            c      g  g c 
5' ucucaagcugugg ucu gcaaagggaagc cuuucu uu u u
   ||||||||||||| ||| |||||||||||| |||||| || | a
3' agaguuuggcauu agg cguuucccuucg gaaaga aa a a
                -   u            c      g  g a 
Get sequence
Deep sequencing
101 reads, 0 reads per million, 33 experiments
Confidence Annotation confidence: high
Feedback: Do you believe this miRNA is real?
Comments

The 5' mature product was previously named miR-527 in [1] and here. Landgraf et al. showed that products from both arms are approximately equally expressed [2]. miR-527 is renamed miR-518a-5p here. The mature sequence shown here represents the most commonly cloned form from large-scale cloning studies [2]. The 5' end of the miRNA may be offset with respect to previous annotations. miR-518a-5p cloned in [2] has a 1 nt 3' extension (A), which is incompatible with the genome sequence.

Genome context
Coordinates (GRCh38; GCA_000001405.15) Overlapping transcripts
chr19: 53739333-53739419 [+]
antisense
OTTHUMT00000464189 ; ZNF677-001; 3'UTR (exon 5)
ENST00000598513 ; ZNF677-001; 3'UTR (exon 5)
ENST00000333952 ; ZNF677-201; 3'UTR (exon 5)
Clustered miRNAs
< 10kb from hsa-mir-518a-2
hsa-mir-518echr19: 53729838-53729925 [+]
hsa-mir-518a-1chr19: 53731006-53731090 [+]
hsa-mir-518dchr19: 53734877-53734963 [+]
hsa-mir-516b-1chr19: 53736845-53736934 [+]
hsa-mir-518a-2chr19: 53739333-53739419 [+]
hsa-mir-517cchr19: 53741313-53741407 [+]
hsa-mir-520hchr19: 53742512-53742599 [+]
hsa-mir-521-1chr19: 53748636-53748722 [+]
Database links

Mature sequence hsa-miR-518a-5p

Accession MIMAT0005457
Sequence

16 - 

cugcaaagggaagcccuuuc

 - 35

Get sequence
Deep sequencing82 reads, 11 experiments
Evidence experimental; array-cloned [1]
Predicted targets

Mature sequence hsa-miR-518a-3p

Accession MIMAT0002863
Previous IDshsa-miR-518a
Sequence

53 - 

gaaagcgcuucccuuugcugga

 - 74

Get sequence
Deep sequencing100 reads, 23 experiments
Evidence experimental; array-cloned [1], cloned [2]
Database links
Predicted targets

References

1
PMID:15965474 "Identification of hundreds of conserved and nonconserved human microRNAs" Bentwich I, Avniel A, Karov Y, Aharonov R, Gilad S, Barad O, Barzilai A, Einat P, Einav U, Meiri E, Sharon E, Spector Y, Bentwich Z Nat Genet. 37:766-770(2005).
2
PMID:17604727 "A mammalian microRNA expression atlas based on small RNA library sequencing" Landgraf P, Rusu M, Sheridan R, Sewer A, Iovino N, Aravin A, Pfeffer S, Rice A, Kamphorst AO, Landthaler M, Lin C, Socci ND, Hermida L, Fulci V, Chiaretti S, Foa R, Schliwka J, Fuchs U, Novosel A, Muller RU, Schermer B, Bissels U, Inman J, Phan Q, Chien M Cell. 129:1401-1414(2007).