|
miRBase |
|
Stem-loop sequence hsa-mir-518a-2 |
|||||
| Accession | MI0003173 | ||||
| Symbol | HGNC:MIR518A2 | ||||
| Description | Homo sapiens miR-518a-2 stem-loop | ||||
| Gene family | MIPF0000020; mir-515 | ||||
| Stem-loop |
g - c g g c ucucaagcugugg ucu gcaaagggaagc cuuucu uu u u ||||||||||||| ||| |||||||||||| |||||| || | a agaguuuggcauu agg cguuucccuucg gaaaga aa a a - u c g g a |
||||
| Deep sequencing |
| ||||
| Comments |
The 5' mature product was previously named miR-527 in [1] and here. Landgraf et al. showed that products from both arms are approximately equally expressed [2]. miR-527 is renamed miR-518a-5p here. The mature sequence shown here represents the most commonly cloned form from large-scale cloning studies [2]. The 5' end of the miRNA may be offset with respect to previous annotations. miR-518a-5p cloned in [2] has a 1 nt 3' extension (A), which is incompatible with the genome sequence. |
||||
| Genome context |
|
||||
| Clustered miRNAs | |||||
| Database links | |||||
Mature sequence hsa-miR-518a-5p |
|
| Accession | MIMAT0005457 |
| Sequence |
16 - cugcaaagggaagcccuuuc - 35 |
| Deep sequencing | 23 reads, 5 experiments |
| Evidence | experimental; array-cloned [1] |
| Validated targets |
|
| Predicted targets |
|
Mature sequence hsa-miR-518a-3p |
|
| Accession | MIMAT0002863 |
| Previous IDs | hsa-miR-518a |
| Sequence |
53 - gaaagcgcuucccuuugcugga - 74 |
| Deep sequencing | 11 reads, 4 experiments |
| Evidence | experimental; array-cloned [1], cloned [2] |
| Predicted targets |
|
References |
|
| 1 |
PMID:15965474
"Identification of hundreds of conserved and nonconserved human microRNAs"
Nat Genet. 37:766-770(2005).
|
| 2 |
PMID:17604727
"A mammalian microRNA expression atlas based on small RNA library sequencing"
Cell. 129:1401-1414(2007).
|