|
miRBase |
|
Stem-loop sequence hsa-mir-516b-1 |
|||||
| Accession | MI0003172 | ||||
| Previous IDs | hsa-mir-516-4 | ||||
| Symbol | HGNC:MIR516B1 | ||||
| Description | Homo sapiens miR-516b-1 stem-loop | ||||
| Gene family | MIPF0000020; mir-515 | ||||
| Stem-loop |
cu a uaa g g ucucagg gugacc ucuggagg gaagcacuuucu uuuu u ||||||| |||||| |||||||| |||||||||||| |||| g agaguuu cauugg agacuuuc cuucgugaaaga aaga a cu g --- a a |
||||
| Deep sequencing |
| ||||
| Genome context |
|
||||
| Clustered miRNAs | |||||
| Database links | |||||
Mature sequence hsa-miR-516b-5p |
|
| Accession | MIMAT0002859 |
| Previous IDs | hsa-miR-516-5p;hsa-miR-516b |
| Sequence |
16 - aucuggagguaagaagcacuuu - 37 |
| Deep sequencing | 276 reads, 2 experiments |
| Evidence | experimental; array-cloned [1], cloned [2] |
| Predicted targets |
|
Mature sequence hsa-miR-516b-3p |
|
| Accession | MIMAT0002860 |
| Previous IDs | hsa-miR-516-3p;hsa-miR-516b*;hsa-miR-516a-3p;hsa-miR-516b*;hsa-miR-516a-3p;hsa-miR-516b* |
| Sequence |
61 - ugcuuccuuucagagggu - 78 |
| Deep sequencing | 4 reads, 1 experiments |
| Evidence | experimental; array-cloned [1] |
| Predicted targets |
|
References |
|
| 1 |
PMID:15965474
"Identification of hundreds of conserved and nonconserved human microRNAs"
Nat Genet. 37:766-770(2005).
|
| 2 |
PMID:17604727
"A mammalian microRNA expression atlas based on small RNA library sequencing"
Cell. 129:1401-1414(2007).
|