Stem-loop sequence hsa-mir-516b-1

AccessionMI0003172 (change log)
Previous IDshsa-mir-516-4
Symbol HGNC:MIR516B1
DescriptionHomo sapiens miR-516b-1 stem-loop
Gene family MIPF0000020; mir-515
Literature search

18 open access papers mention hsa-mir-516b-1
(36 sentences)

Stem-loop
          cu      a        uaa            g    g 
5' ucucagg  gugacc ucuggagg   gaagcacuuucu uuuu u
   |||||||  |||||| ||||||||   |||||||||||| |||| g
3' agaguuu  cauugg agacuuuc   cuucgugaaaga aaga a
          cu      g        ---            a    a 
Get sequence
Deep sequencing
939 reads, 0 reads per million, 76 experiments
Confidence Annotation confidence: not enough data
Feedback: Do you believe this miRNA is real?
Genome context
Coordinates (GRCh38; GCA_000001405.15) Overlapping transcripts
chr19: 53736845-53736934 [+]
antisense
ENST00000333952 ; ZNF677-201; 3'UTR (exon 6)
Clustered miRNAs
< 10kb from hsa-mir-516b-1
hsa-mir-526a-2chr19: 53726922-53726986 [+]
hsa-mir-518echr19: 53729838-53729925 [+]
hsa-mir-518a-1chr19: 53731006-53731090 [+]
hsa-mir-518dchr19: 53734877-53734963 [+]
hsa-mir-516b-1chr19: 53736845-53736934 [+]
hsa-mir-518a-2chr19: 53739333-53739419 [+]
hsa-mir-517cchr19: 53741313-53741407 [+]
hsa-mir-520hchr19: 53742512-53742599 [+]
Database links

Mature sequence hsa-miR-516b-5p

Accession MIMAT0002859
Previous IDshsa-miR-516-5p;hsa-miR-516b
Sequence

16 - 

aucuggagguaagaagcacuuu

 - 37

Get sequence
Deep sequencing1217 reads, 50 experiments
Evidence experimental; array-cloned [1], cloned [2]
Database links
Predicted targets

Mature sequence hsa-miR-516b-3p

Accession MIMAT0002860
Previous IDshsa-miR-516-3p;hsa-miR-516b*;hsa-miR-516a-3p;hsa-miR-516b*;hsa-miR-516a-3p;hsa-miR-516b*
Sequence

61 - 

ugcuuccuuucagagggu

 - 78

Get sequence
Deep sequencing462 reads, 29 experiments
Evidence experimental; array-cloned [1]
Predicted targets

References

1
PMID:15965474 "Identification of hundreds of conserved and nonconserved human microRNAs" Bentwich I, Avniel A, Karov Y, Aharonov R, Gilad S, Barad O, Barzilai A, Einat P, Einav U, Meiri E, Sharon E, Spector Y, Bentwich Z Nat Genet. 37:766-770(2005).
2
PMID:17604727 "A mammalian microRNA expression atlas based on small RNA library sequencing" Landgraf P, Rusu M, Sheridan R, Sewer A, Iovino N, Aravin A, Pfeffer S, Rice A, Kamphorst AO, Landthaler M, Lin C, Socci ND, Hermida L, Fulci V, Chiaretti S, Foa R, Schliwka J, Fuchs U, Novosel A, Muller RU, Schermer B, Bissels U, Inman J, Phan Q, Chien M Cell. 129:1401-1414(2007).