|
miRBase |
|
Stem-loop sequence hsa-mir-518d |
|||||
| Accession | MI0003171 | ||||
| Symbol | HGNC:MIR518D | ||||
| Description | Homo sapiens miR-518d stem-loop | ||||
| Gene family | MIPF0000020; mir-515 | ||||
| Stem-loop |
c u c a cu g u uc ca gcugugac cucuagagggaagc cuuu guu uc g || || |||||||| |||||||||||||| |||| ||| || a ag gu uggcauug gagguuucccuucg gaaa caa ag a a u c c -c - a |
||||
| Deep sequencing |
| ||||
| Comments |
The mature sequence shown here represents the most commonly cloned form from large-scale cloning studies [2]. |
||||
| Genome context |
|
||||
| Clustered miRNAs | |||||
| Database links | |||||
Mature sequence hsa-miR-518d-5p |
|
| Accession | MIMAT0005456 |
| Sequence |
16 - cucuagagggaagcacuuucug - 37 |
| Deep sequencing | 11 reads, 2 experiments |
| Evidence | experimental; array-cloned [1], cloned [2] |
| Predicted targets |
|
Mature sequence hsa-miR-518d-3p |
|
| Accession | MIMAT0002864 |
| Previous IDs | hsa-miR-518d |
| Sequence |
53 - caaagcgcuucccuuuggagc - 73 |
| Deep sequencing | 2 reads, 2 experiments |
| Evidence | experimental; array-cloned [1] |
| Predicted targets |
|
References |
|
| 1 |
PMID:15965474
"Identification of hundreds of conserved and nonconserved human microRNAs"
Nat Genet. 37:766-770(2005).
|
| 2 |
PMID:17604727
"A mammalian microRNA expression atlas based on small RNA library sequencing"
Cell. 129:1401-1414(2007).
|