Stem-loop sequence hsa-mir-518d

AccessionMI0003171 (change log)
Symbol HGNC:MIR518D
DescriptionHomo sapiens miR-518d stem-loop
Gene family MIPF0000020; mir-515
Literature search

11 open access papers mention hsa-mir-518d
(15 sentences)

Stem-loop
     c  u        c              a    cu   g  u 
5' uc ca gcugugac cucuagagggaagc cuuu  guu uc g
   || || |||||||| |||||||||||||| ||||  ||| || a
3' ag gu uggcauug gagguuucccuucg gaaa  caa ag a
     a  u        c              c    -c   -  a 
Get sequence
Deep sequencing
247 reads, 0 reads per million, 57 experiments
Confidence Annotation confidence: not enough data
Feedback: Do you believe this miRNA is real?
Comments

The mature sequence shown here represents the most commonly cloned form from large-scale cloning studies [2].

Genome context
Coordinates (GRCh38; GCA_000001405.15) Overlapping transcripts
chr19: 53734877-53734963 [+]
antisense
ENST00000333952 ; ZNF677-201; 3'UTR (exon 6)
Clustered miRNAs
< 10kb from hsa-mir-518d
hsa-mir-516b-2chr19: 53725442-53725526 [+]
hsa-mir-526a-2chr19: 53726922-53726986 [+]
hsa-mir-518echr19: 53729838-53729925 [+]
hsa-mir-518a-1chr19: 53731006-53731090 [+]
hsa-mir-518dchr19: 53734877-53734963 [+]
hsa-mir-516b-1chr19: 53736845-53736934 [+]
hsa-mir-518a-2chr19: 53739333-53739419 [+]
hsa-mir-517cchr19: 53741313-53741407 [+]
hsa-mir-520hchr19: 53742512-53742599 [+]
Database links

Mature sequence hsa-miR-518d-5p

Accession MIMAT0005456
Sequence

16 - 

cucuagagggaagcacuuucug

 - 37

Get sequence
Deep sequencing170 reads, 50 experiments
Evidence experimental; array-cloned [1], cloned [2]
Predicted targets

Mature sequence hsa-miR-518d-3p

Accession MIMAT0002864
Previous IDshsa-miR-518d
Sequence

53 - 

caaagcgcuucccuuuggagc

 - 73

Get sequence
Deep sequencing75 reads, 19 experiments
Evidence experimental; array-cloned [1]
Predicted targets

References

1
PMID:15965474 "Identification of hundreds of conserved and nonconserved human microRNAs" Bentwich I, Avniel A, Karov Y, Aharonov R, Gilad S, Barad O, Barzilai A, Einat P, Einav U, Meiri E, Sharon E, Spector Y, Bentwich Z Nat Genet. 37:766-770(2005).
2
PMID:17604727 "A mammalian microRNA expression atlas based on small RNA library sequencing" Landgraf P, Rusu M, Sheridan R, Sewer A, Iovino N, Aravin A, Pfeffer S, Rice A, Kamphorst AO, Landthaler M, Lin C, Socci ND, Hermida L, Fulci V, Chiaretti S, Foa R, Schliwka J, Fuchs U, Novosel A, Muller RU, Schermer B, Bissels U, Inman J, Phan Q, Chien M Cell. 129:1401-1414(2007).