Stem-loop sequence hsa-mir-518e

AccessionMI0003169 (change log)
Symbol HGNC:MIR518E
DescriptionHomo sapiens miR-518e stem-loop
Gene family MIPF0000020; mir-515
Literature search

9 open access papers mention hsa-mir-518e
(11 sentences)

Stem-loop
         -  ug    c    ag               guuggc 
5' ucucag gc  ugac cucu  agggaagcgcuuucu      u
   |||||| ||  |||| ||||  |||||||||||||||      a
3' agaguu cg  auug gaga  ucccuucgcgaaaga      a
         u  ca    u    cu               aaagaa 
Get sequence
Deep sequencing
577 reads, 3.17 reads per million, 63 experiments
Confidence Annotation confidence: high
Feedback: Do you believe this miRNA is real?
Genome context
Coordinates (GRCh38; GCA_000001405.15) Overlapping transcripts
chr19: 53729838-53729925 [+]
intergenic
Clustered miRNAs
< 10kb from hsa-mir-518e
hsa-mir-520dchr19: 53720096-53720182 [+]
hsa-mir-517bchr19: 53721076-53721142 [+]
hsa-mir-520gchr19: 53722166-53722255 [+]
hsa-mir-516b-2chr19: 53725442-53725526 [+]
hsa-mir-526a-2chr19: 53726922-53726986 [+]
hsa-mir-518echr19: 53729838-53729925 [+]
hsa-mir-518a-1chr19: 53731006-53731090 [+]
hsa-mir-518dchr19: 53734877-53734963 [+]
hsa-mir-516b-1chr19: 53736845-53736934 [+]
hsa-mir-518a-2chr19: 53739333-53739419 [+]
Database links

Mature sequence hsa-miR-518e-5p

Accession MIMAT0005450
Previous IDshsa-miR-518e*
Sequence

16 - 

cucuagagggaagcgcuuucug

 - 37

Get sequence
Deep sequencing509 reads, 49 experiments
Evidence experimental; array-cloned [1], cloned [2]
Database links
Predicted targets

Mature sequence hsa-miR-518e-3p

Accession MIMAT0002861
Previous IDshsa-miR-518e
Sequence

54 - 

aaagcgcuucccuucagagug

 - 74

Get sequence
Deep sequencing55 reads, 23 experiments
Evidence experimental; array-cloned [1], cloned [2]
Predicted targets

References

1
PMID:15965474 "Identification of hundreds of conserved and nonconserved human microRNAs" Bentwich I, Avniel A, Karov Y, Aharonov R, Gilad S, Barad O, Barzilai A, Einat P, Einav U, Meiri E, Sharon E, Spector Y, Bentwich Z Nat Genet. 37:766-770(2005).
2
PMID:17604727 "A mammalian microRNA expression atlas based on small RNA library sequencing" Landgraf P, Rusu M, Sheridan R, Sewer A, Iovino N, Aravin A, Pfeffer S, Rice A, Kamphorst AO, Landthaler M, Lin C, Socci ND, Hermida L, Fulci V, Chiaretti S, Foa R, Schliwka J, Fuchs U, Novosel A, Muller RU, Schermer B, Bissels U, Inman J, Phan Q, Chien M Cell. 129:1401-1414(2007).