Stem-loop sequence hsa-mir-526a-2

Accession MI0003168
Symbol HGNC:MIR526A2
Description Homo sapiens miR-526a-2 stem-loop
Gene family MIPF0000020; mir-515
Stem-loop 
          ag     a   cu    -g  g 
gugacccucu  aggga gca  uucu  uu a
||||||||||  ||||| |||  ||||  ||  
cauugggaga  uuccu cgu  aaga  ag a
          cu     a   ac    aa  a
Get sequence
Deep sequencing
12 reads, 3 experiments
Comments

The mature sequence shown here represents the most commonly cloned form from large-scale cloning studies [2].

Genome context
Coordinates (GRCh37.p5) Overlapping transcripts
chr19: 54230176-54230240 [+]
intergenic
Clustered miRNAs
< 10kb from hsa-mir-526a-2
hsa-mir-520d chr19: 54223350-54223436 [+]
hsa-mir-517b chr19: 54224330-54224396 [+]
hsa-mir-520g chr19: 54225420-54225509 [+]
hsa-mir-516b-2 chr19: 54228696-54228780 [+]
hsa-mir-526a-2 chr19: 54230176-54230240 [+]
hsa-mir-518e chr19: 54233092-54233179 [+]
hsa-mir-518a-1 chr19: 54234260-54234344 [+]
hsa-mir-518d chr19: 54238131-54238217 [+]
hsa-mir-516b-1 chr19: 54240099-54240188 [+]
Database links

Mature sequence hsa-miR-526a

Accession MIMAT0002845
Sequence

7 -  

cucuagagggaagcacuuucug

 - 28

Get sequence
Deep sequencing 22 reads, 3 experiments
Evidence experimental; array-cloned [1], cloned [2]
Predicted targets

References

1
PMID:15965474 "Identification of hundreds of conserved and nonconserved human microRNAs" Bentwich I, Avniel A, Karov Y, Aharonov R, Gilad S, Barad O, Barzilai A, Einat P, Einav U, Meiri E, Sharon E, Spector Y, Bentwich Z Nat Genet. 37:766-770(2005).
2
PMID:17604727 "A mammalian microRNA expression atlas based on small RNA library sequencing" Landgraf P, Rusu M, Sheridan R, Sewer A, Iovino N, Aravin A, Pfeffer S, Rice A, Kamphorst AO, Landthaler M, Lin C, Socci ND, Hermida L, Fulci V, Chiaretti S, Foa R, Schliwka J, Fuchs U, Novosel A, Muller RU, Schermer B, Bissels U, Inman J, Phan Q, Chien M Cell. 129:1401-1414(2007).