Stem-loop sequence hsa-mir-526a-2

AccessionMI0003168 (change log)
Symbol HGNC:MIR526A2
DescriptionHomo sapiens miR-526a-2 stem-loop
Gene family MIPF0000020; mir-515
Literature search

11 open access papers mention hsa-mir-526a-2
(24 sentences)

Stem-loop
             ag     a   cu    -g  g 
5' gugacccucu  aggga gca  uucu  uu a
   ||||||||||  ||||| |||  ||||  ||  
3' cauugggaga  uuccu cgu  aaga  ag a
             cu     a   ac    aa  a 
Get sequence
Deep sequencing
177 reads, 0 reads per million, 52 experiments
Confidence Annotation confidence: not enough data
Feedback: Do you believe this miRNA is real?
Comments

The mature sequence shown here represents the most commonly cloned form from large-scale cloning studies [2].

Genome context
Coordinates (GRCh38; GCA_000001405.15) Overlapping transcripts
chr19: 53726922-53726986 [+]
intergenic
Clustered miRNAs
< 10kb from hsa-mir-526a-2
hsa-mir-520dchr19: 53720096-53720182 [+]
hsa-mir-517bchr19: 53721076-53721142 [+]
hsa-mir-520gchr19: 53722166-53722255 [+]
hsa-mir-516b-2chr19: 53725442-53725526 [+]
hsa-mir-526a-2chr19: 53726922-53726986 [+]
hsa-mir-518echr19: 53729838-53729925 [+]
hsa-mir-518a-1chr19: 53731006-53731090 [+]
hsa-mir-518dchr19: 53734877-53734963 [+]
hsa-mir-516b-1chr19: 53736845-53736934 [+]
Database links

Mature sequence hsa-miR-526a-5p

Accession MIMAT0002845
Sequence

7 - 

cucuagagggaagcacuuucug

 - 28

Get sequence
Deep sequencing340 reads, 50 experiments
Evidence experimental; array-cloned [1], cloned [2]
Predicted targets

References

1
PMID:15965474 "Identification of hundreds of conserved and nonconserved human microRNAs" Bentwich I, Avniel A, Karov Y, Aharonov R, Gilad S, Barad O, Barzilai A, Einat P, Einav U, Meiri E, Sharon E, Spector Y, Bentwich Z Nat Genet. 37:766-770(2005).
2
PMID:17604727 "A mammalian microRNA expression atlas based on small RNA library sequencing" Landgraf P, Rusu M, Sheridan R, Sewer A, Iovino N, Aravin A, Pfeffer S, Rice A, Kamphorst AO, Landthaler M, Lin C, Socci ND, Hermida L, Fulci V, Chiaretti S, Foa R, Schliwka J, Fuchs U, Novosel A, Muller RU, Schermer B, Bissels U, Inman J, Phan Q, Chien M Cell. 129:1401-1414(2007).