Stem-loop sequence hsa-mir-520g

AccessionMI0003166 (change log)
Symbol HGNC:MIR520G
DescriptionHomo sapiens miR-520g stem-loop
Gene family MIPF0000020; mir-515
Stem-loop
        u  u     c         -        uc     guugu 
5' uccca gc gugac cucuagagg aagcacuu  uguuu     c
   ||||| || ||||| ||||||||| ||||||||  |||||     u
3' agggu ug cauug gagauuucc uucgugaa  acaaa     g
        u  c     u         c        --     aaaga 
Get sequence
Deep sequencing
1393 reads, 64.7 reads per million, 17 experiments
Confidence
Feedback: Do you believe this miRNA is real?
Genome context
Coordinates (GRCh38; GCA_000001405.15) Overlapping transcripts
chr19: 53722166-53722255 [+]
intergenic
Clustered miRNAs
< 10kb from hsa-mir-520g
hsa-mir-517achr19: 53712268-53712354 [+]
hsa-mir-519dchr19: 53713347-53713434 [+]
hsa-mir-521-2chr19: 53716594-53716680 [+]
hsa-mir-520dchr19: 53720096-53720182 [+]
hsa-mir-517bchr19: 53721076-53721142 [+]
hsa-mir-520gchr19: 53722166-53722255 [+]
hsa-mir-516b-2chr19: 53725442-53725526 [+]
hsa-mir-526a-2chr19: 53726922-53726986 [+]
hsa-mir-518echr19: 53729838-53729925 [+]
hsa-mir-518a-1chr19: 53731006-53731090 [+]
Database links

Mature sequence hsa-miR-520g-5p

Accession MIMAT0026611
Sequence

17 - 

ucuagaggaagcacuuucuguuu

 - 39

Get sequence
Deep sequencing4 reads, 4 experiments
Evidence experimental; Illumina [3]
Predicted targets

Mature sequence hsa-miR-520g-3p

Accession MIMAT0002858
Sequence

55 - 

acaaagugcuucccuuuagagugu

 - 78

Get sequence
Deep sequencing1389 reads, 23 experiments
Evidence experimental; array-cloned [1], cloned [2], Illumina [3]
Database links
Predicted targets

References

1
PMID:15965474 "Identification of hundreds of conserved and nonconserved human microRNAs" Bentwich I, Avniel A, Karov Y, Aharonov R, Gilad S, Barad O, Barzilai A, Einat P, Einav U, Meiri E, Sharon E, Spector Y, Bentwich Z Nat Genet. 37:766-770(2005).
2
PMID:17604727 "A mammalian microRNA expression atlas based on small RNA library sequencing" Landgraf P, Rusu M, Sheridan R, Sewer A, Iovino N, Aravin A, Pfeffer S, Rice A, Kamphorst AO, Landthaler M, Lin C, Socci ND, Hermida L, Fulci V, Chiaretti S, Foa R, Schliwka J, Fuchs U, Novosel A, Muller RU, Schermer B, Bissels U, Inman J, Phan Q, Chien M Cell. 129:1401-1414(2007).
3
PMID:23034410 "Birth and expression evolution of mammalian microRNA genes" Meunier J, Lemoine F, Soumillon M, Liechti A, Weier M, Guschanski K, Hu H, Khaitovich P, Kaessmann H Genome Res. 23:34-45(2013).