|
miRBase |
|
Stem-loop sequence hsa-mir-517b |
|||||
| Accession | MI0003165 | ||||
| Symbol | HGNC:MIR517B | ||||
| Description | Homo sapiens miR-517b stem-loop | ||||
| Gene family | MIPF0000020; mir-515 | ||||
| Stem-loop |
c u a u guugu gugac cucuaga gga gcac gucu c ||||| ||||||| ||| |||| |||| u cauug gagauuu ccu cgug uaga a u c a c aaaga |
||||
| Deep sequencing |
| ||||
| Genome context |
|
||||
| Clustered miRNAs | |||||
| Database links | |||||
Mature sequence hsa-miR-517-5p |
|
| Accession | MIMAT0002851 |
| Previous IDs | hsa-miR-517* |
| Sequence |
6 - ccucuagauggaagcacugucu - 27 |
| Deep sequencing | 2 reads, 1 experiments |
| Evidence | experimental; array-cloned [1] |
| Predicted targets |
|
Mature sequence hsa-miR-517b-3p |
|
| Accession | MIMAT0002857 |
| Previous IDs | hsa-miR-517b |
| Sequence |
43 - aucgugcaucccuuuagagugu - 64 |
| Deep sequencing | 30 reads, 6 experiments |
| Evidence | experimental; array-cloned [1] |
| Predicted targets |
|
References |
|
| 1 |
PMID:15965474
"Identification of hundreds of conserved and nonconserved human microRNAs"
Nat Genet. 37:766-770(2005).
|