Stem-loop sequence hsa-mir-517b

AccessionMI0003165 (change log)
Symbol HGNC:MIR517B
DescriptionHomo sapiens miR-517b stem-loop
Gene family MIPF0000020; mir-515
Literature search

20 open access papers mention hsa-mir-517b
(60 sentences)

Stem-loop
        c       u   a    u    guugu 
5' gugac cucuaga gga gcac gucu     c
   ||||| ||||||| ||| |||| ||||     u
3' cauug gagauuu ccu cgug uaga     a
        u       c   a    c    aaaga 
Get sequence
Deep sequencing
495 reads, 1.33 reads per million, 75 experiments
Confidence Annotation confidence: not enough data
Feedback: Do you believe this miRNA is real?
Genome context
Coordinates (GRCh38; GCA_000001405.15) Overlapping transcripts
chr19: 53721076-53721142 [+]
intergenic
Clustered miRNAs
< 10kb from hsa-mir-517b
hsa-mir-517achr19: 53712268-53712354 [+]
hsa-mir-519dchr19: 53713347-53713434 [+]
hsa-mir-521-2chr19: 53716594-53716680 [+]
hsa-mir-520dchr19: 53720096-53720182 [+]
hsa-mir-517bchr19: 53721076-53721142 [+]
hsa-mir-520gchr19: 53722166-53722255 [+]
hsa-mir-516b-2chr19: 53725442-53725526 [+]
hsa-mir-526a-2chr19: 53726922-53726986 [+]
hsa-mir-518echr19: 53729838-53729925 [+]
hsa-mir-518a-1chr19: 53731006-53731090 [+]
Database links

Mature sequence hsa-miR-517-5p

Accession MIMAT0002851
Previous IDshsa-miR-517*
Sequence

6 - 

ccucuagauggaagcacugucu

 - 27

Get sequence
Deep sequencing45 reads, 11 experiments
Evidence experimental; array-cloned [1]
Predicted targets

Mature sequence hsa-miR-517b-3p

Accession MIMAT0002857
Previous IDshsa-miR-517b
Sequence

43 - 

aucgugcaucccuuuagagugu

 - 64

Get sequence
Deep sequencing477 reads, 70 experiments
Evidence experimental; array-cloned [1]
Database links
Predicted targets

References

1
PMID:15965474 "Identification of hundreds of conserved and nonconserved human microRNAs" Bentwich I, Avniel A, Karov Y, Aharonov R, Gilad S, Barad O, Barzilai A, Einat P, Einav U, Meiri E, Sharon E, Spector Y, Bentwich Z Nat Genet. 37:766-770(2005).