Stem-loop sequence hsa-mir-521-2

AccessionMI0003163 (change log)
Symbol HGNC:MIR521-2
DescriptionHomo sapiens miR-521-2 stem-loop
Gene family MIPF0000020; mir-515
Literature search

10 open access papers mention hsa-mir-521-2
(15 sentences)

Stem-loop
        g  u     u   c         ---aa    c    gu 
5' ucucg gc gugac cuc aaagggaag     uuuu ucuu  c
   ||||| || ||||| ||| |||||||||     |||| ||||   
3' agagu ug cauug gag uuucccuuc     agaa agaa  u
        g  c     u   a         acgca    a    aa 
Get sequence
Deep sequencing
83 reads, 13.8 reads per million, 29 experiments
Confidence Annotation confidence: not enough data
Feedback: Do you believe this miRNA is real?
Genome context
Coordinates (GRCh38; GCA_000001405.15) Overlapping transcripts
chr19: 53716594-53716680 [+]
sense
OTTHUMT00000464187 ; ZNF818P-001; exon 1
ENST00000598377 ; ZNF818P-001; exon 1
Clustered miRNAs
< 10kb from hsa-mir-521-2
hsa-mir-520cchr19: 53707453-53707539 [+]
hsa-mir-518cchr19: 53708735-53708835 [+]
hsa-mir-524chr19: 53711002-53711088 [+]
hsa-mir-517achr19: 53712268-53712354 [+]
hsa-mir-519dchr19: 53713347-53713434 [+]
hsa-mir-521-2chr19: 53716594-53716680 [+]
hsa-mir-520dchr19: 53720096-53720182 [+]
hsa-mir-517bchr19: 53721076-53721142 [+]
hsa-mir-520gchr19: 53722166-53722255 [+]
hsa-mir-516b-2chr19: 53725442-53725526 [+]
Database links

Mature sequence hsa-miR-521

Accession MIMAT0002854
Sequence

54 - 

aacgcacuucccuuuagagugu

 - 75

Get sequence
Deep sequencing122 reads, 18 experiments
Evidence experimental; array-cloned [1], cloned [2]
Database links
Predicted targets

References

1
PMID:15965474 "Identification of hundreds of conserved and nonconserved human microRNAs" Bentwich I, Avniel A, Karov Y, Aharonov R, Gilad S, Barad O, Barzilai A, Einat P, Einav U, Meiri E, Sharon E, Spector Y, Bentwich Z Nat Genet. 37:766-770(2005).
2
PMID:17604727 "A mammalian microRNA expression atlas based on small RNA library sequencing" Landgraf P, Rusu M, Sheridan R, Sewer A, Iovino N, Aravin A, Pfeffer S, Rice A, Kamphorst AO, Landthaler M, Lin C, Socci ND, Hermida L, Fulci V, Chiaretti S, Foa R, Schliwka J, Fuchs U, Novosel A, Muller RU, Schermer B, Bissels U, Inman J, Phan Q, Chien M Cell. 129:1401-1414(2007).