Stem-loop sequence hsa-mir-524

AccessionMI0003160
Symbol HGNC:MIR524
DescriptionHomo sapiens miR-524 stem-loop
Gene family MIPF0000020; mir-515
Stem-loop
        u        c  a           a      cuug     
5' ucuca gcugugac cu caaagggaagc cuuucu    ucca 
   ||||| |||||||| || ||||||||||| ||||||    ||| a
3' agagu uggcauug ga guuucccuucg ggaaga    agga 
        u        u  g           c      --aa     
Get sequence
Deep sequencing
52 reads, 133 reads per million, 16 experiments
Confidence
Feedback: Do you believe this miRNA is real?
Genome context
Coordinates (GRCh38) Overlapping transcripts
chr19: 53711002-53711088 [+]
sense
OTTHUMT00000464185 ; CTD-2245F17.3-001; intron 4
ENST00000597550 ; CTD-2245F17.3-001; intron 4
Clustered miRNAs
< 10kb from hsa-mir-524
hsa-mir-520bchr19: 53701227-53701287 [+]
hsa-mir-518bchr19: 53702737-53702819 [+]
hsa-mir-526a-1chr19: 53706252-53706336 [+]
hsa-mir-520cchr19: 53707453-53707539 [+]
hsa-mir-518cchr19: 53708735-53708835 [+]
hsa-mir-524chr19: 53711002-53711088 [+]
hsa-mir-517achr19: 53712268-53712354 [+]
hsa-mir-519dchr19: 53713347-53713434 [+]
hsa-mir-521-2chr19: 53716594-53716680 [+]
hsa-mir-520dchr19: 53720096-53720182 [+]
Database links

Mature sequence hsa-miR-524-5p

Accession MIMAT0002849
Previous IDshsa-miR-524*
Sequence

16 - 

cuacaaagggaagcacuuucuc

 - 37

Get sequence
Deep sequencing20 reads, 9 experiments
Evidence experimental; array-cloned [1], cloned [2]
Predicted targets

Mature sequence hsa-miR-524-3p

Accession MIMAT0002850
Previous IDshsa-miR-524
Sequence

53 - 

gaaggcgcuucccuuuggagu

 - 73

Get sequence
Evidence experimental; array-cloned [1]
Predicted targets

References

1
PMID:15965474 "Identification of hundreds of conserved and nonconserved human microRNAs" Bentwich I, Avniel A, Karov Y, Aharonov R, Gilad S, Barad O, Barzilai A, Einat P, Einav U, Meiri E, Sharon E, Spector Y, Bentwich Z Nat Genet. 37:766-770(2005).
2
PMID:17604727 "A mammalian microRNA expression atlas based on small RNA library sequencing" Landgraf P, Rusu M, Sheridan R, Sewer A, Iovino N, Aravin A, Pfeffer S, Rice A, Kamphorst AO, Landthaler M, Lin C, Socci ND, Hermida L, Fulci V, Chiaretti S, Foa R, Schliwka J, Fuchs U, Novosel A, Muller RU, Schermer B, Bissels U, Inman J, Phan Q, Chien M Cell. 129:1401-1414(2007).