Stem-loop sequence hsa-mir-520c

Accession MI0003158
Symbol HGNC:MIR520C
Description Homo sapiens miR-520c stem-loop
Gene family MIPF0000020; mir-515
Stem-loop 
        u  cg                       guug  u 
ucucaggc gu  uccucuagagggaagcacuuucu    uc g
|||||||| ||  |||||||||||||||||||||||    || a
agaguuug ca  gggagauuuuccuucgugaaaga    ag a
        c  uu                       --aa  a
Get sequence
Deep sequencing
64 reads, 4 experiments
Comments

The 5' arm of this precursor expresses a product related to miR-526 (previously named miR-526c here). Landgraf et al. confirm mature miRNA expression from both arms of the precursor [2], leading to the -5p, -3p designations. The mature sequence shown here represents the most commonly cloned form from large-scale cloning studies [2].

Genome context
Coordinates (GRCh37.p5) Overlapping transcripts
chr19: 54210707-54210793 [+]
intergenic
Clustered miRNAs
< 10kb from hsa-mir-520c
hsa-mir-525 chr19: 54200787-54200871 [+]
hsa-mir-523 chr19: 54201639-54201725 [+]
hsa-mir-518f chr19: 54203269-54203355 [+]
hsa-mir-520b chr19: 54204481-54204541 [+]
hsa-mir-518b chr19: 54205991-54206073 [+]
hsa-mir-526a-1 chr19: 54209506-54209590 [+]
hsa-mir-520c chr19: 54210707-54210793 [+]
hsa-mir-518c chr19: 54211989-54212089 [+]
hsa-mir-524 chr19: 54214256-54214342 [+]
hsa-mir-517a chr19: 54215522-54215608 [+]
hsa-mir-519d chr19: 54216601-54216688 [+]
hsa-mir-521-2 chr19: 54219848-54219934 [+]
Database links

Mature sequence hsa-miR-520c-5p

Accession MIMAT0005455
Sequence

16 -  

cucuagagggaagcacuuucug

 - 37

Get sequence
Deep sequencing 10 reads, 1 experiments
Evidence experimental; array-cloned [1], cloned [2]
Predicted targets

Mature sequence hsa-miR-520c-3p

Accession MIMAT0002846
Previous IDs hsa-miR-520c
Sequence

54 -  

aaagugcuuccuuuuagagggu

 - 75

Get sequence
Deep sequencing 54 reads, 4 experiments
Evidence experimental; array-cloned [1], cloned [2]
Validated targets
Predicted targets

References

1
PMID:15965474 "Identification of hundreds of conserved and nonconserved human microRNAs" Bentwich I, Avniel A, Karov Y, Aharonov R, Gilad S, Barad O, Barzilai A, Einat P, Einav U, Meiri E, Sharon E, Spector Y, Bentwich Z Nat Genet. 37:766-770(2005).
2
PMID:17604727 "A mammalian microRNA expression atlas based on small RNA library sequencing" Landgraf P, Rusu M, Sheridan R, Sewer A, Iovino N, Aravin A, Pfeffer S, Rice A, Kamphorst AO, Landthaler M, Lin C, Socci ND, Hermida L, Fulci V, Chiaretti S, Foa R, Schliwka J, Fuchs U, Novosel A, Muller RU, Schermer B, Bissels U, Inman J, Phan Q, Chien M Cell. 129:1401-1414(2007).