Stem-loop sequence hsa-mir-526a-1

AccessionMI0003157 (change log)
Symbol HGNC:MIR526A1
DescriptionHomo sapiens miR-526a-1 stem-loop
Gene family MIPF0000020; mir-515
Literature search

11 open access papers mention hsa-mir-526a-1
(24 sentences)

Stem-loop
         cu    c               a      g  g  u 
5' cucagg  guga ccucuagagggaagc cuuucu uu cu g
   ||||||  |||| ||||||||||||||| |||||| || ||  
3' gaguuu  cauu ggagauuuuccuucg gaaaga aa ga a
         cu    a               c      g  -  a 
Get sequence
Deep sequencing
361 reads, 23.5 reads per million, 68 experiments
Confidence Annotation confidence: not enough data
Feedback: Do you believe this miRNA is real?
Genome context
Coordinates (GRCh38; GCA_000001405.15) Overlapping transcripts
chr19: 53706252-53706336 [+]
sense
OTTHUMT00000464186 ; CTD-2245F17.3-002; intron 2
OTTHUMT00000464185 ; CTD-2245F17.3-001; intron 3
ENST00000601072 ; CTD-2245F17.3-002; intron 2
ENST00000597550 ; CTD-2245F17.3-001; intron 3
Clustered miRNAs
< 10kb from hsa-mir-526a-1
hsa-mir-525chr19: 53697533-53697617 [+]
hsa-mir-523chr19: 53698385-53698471 [+]
hsa-mir-518fchr19: 53700015-53700101 [+]
hsa-mir-520bchr19: 53701227-53701287 [+]
hsa-mir-518bchr19: 53702737-53702819 [+]
hsa-mir-526a-1chr19: 53706252-53706336 [+]
hsa-mir-520cchr19: 53707453-53707539 [+]
hsa-mir-518cchr19: 53708735-53708835 [+]
hsa-mir-524chr19: 53711002-53711088 [+]
hsa-mir-517achr19: 53712268-53712354 [+]
hsa-mir-519dchr19: 53713347-53713434 [+]
Database links

Mature sequence hsa-miR-526a-5p

Accession MIMAT0002845
Sequence

15 - 

cucuagagggaagcacuuucug

 - 36

Get sequence
Deep sequencing340 reads, 50 experiments
Evidence experimental; array-cloned [1], cloned [2]
Predicted targets

Mature sequence hsa-miR-526a-3p

Accession MIMAT0037326
Sequence

52 - 

gaaagcgcuuccuuuuagagga

 - 73

Get sequence
Deep sequencing166 reads, 22 experiments
Evidence experimental; Illumina [3]

References

1
PMID:15965474 "Identification of hundreds of conserved and nonconserved human microRNAs" Bentwich I, Avniel A, Karov Y, Aharonov R, Gilad S, Barad O, Barzilai A, Einat P, Einav U, Meiri E, Sharon E, Spector Y, Bentwich Z Nat Genet. 37:766-770(2005).
2
PMID:17604727 "A mammalian microRNA expression atlas based on small RNA library sequencing" Landgraf P, Rusu M, Sheridan R, Sewer A, Iovino N, Aravin A, Pfeffer S, Rice A, Kamphorst AO, Landthaler M, Lin C, Socci ND, Hermida L, Fulci V, Chiaretti S, Foa R, Schliwka J, Fuchs U, Novosel A, Muller RU, Schermer B, Bissels U, Inman J, Phan Q, Chien M Cell. 129:1401-1414(2007).
3
PMID:25822230 "Selective microRNA-Offset RNA expression in human embryonic stem cells" Asikainen S, Heikkinen L, Juhila J, Holm F, Weltner J, Trokovic R, Mikkola M, Toivonen S, Balboa D, Lampela R, Icay K, Tuuri T, Otonkoski T, Wong G, Hovatta O PLoS One. 10:e0116668(2015).