Stem-loop sequence hsa-mir-518b

AccessionMI0003156
Symbol HGNC:MIR518B
DescriptionHomo sapiens miR-518b stem-loop
Gene family MIPF0000020; mir-515
Stem-loop
      u      gc    c      a       uc    g  u 
5' uca gcugug  ccuc agaggg agcgcuu  uguu uc g
   ||| ||||||  |||| |||||| |||||||  |||| || a
3' agu uggcau  ggag uuuccc ucgcgaa  acaa ag a
      u      uu    a      c       --    a  a 
Get sequence
Deep sequencing
181 reads, 148 reads per million, 22 experiments
Confidence
Feedback: Do you believe this miRNA is real?
Genome context
Coordinates (GRCh38) Overlapping transcripts
chr19: 53702737-53702819 [+]
sense
OTTHUMT00000464185 ; CTD-2245F17.3-001; intron 1
OTTHUMT00000464186 ; CTD-2245F17.3-002; intron 1
ENST00000597550 ; CTD-2245F17.3-001; intron 1
ENST00000601072 ; CTD-2245F17.3-002; intron 1
Clustered miRNAs
< 10kb from hsa-mir-518b
hsa-mir-526bchr19: 53694393-53694475 [+]
hsa-mir-519bchr19: 53695213-53695293 [+]
hsa-mir-525chr19: 53697533-53697617 [+]
hsa-mir-523chr19: 53698385-53698471 [+]
hsa-mir-518fchr19: 53700015-53700101 [+]
hsa-mir-520bchr19: 53701227-53701287 [+]
hsa-mir-518bchr19: 53702737-53702819 [+]
hsa-mir-526a-1chr19: 53706252-53706336 [+]
hsa-mir-520cchr19: 53707453-53707539 [+]
hsa-mir-518cchr19: 53708735-53708835 [+]
hsa-mir-524chr19: 53711002-53711088 [+]
hsa-mir-517achr19: 53712268-53712354 [+]
Database links

Mature sequence hsa-miR-518b

Accession MIMAT0002844
Sequence

51 - 

caaagcgcuccccuuuagaggu

 - 72

Get sequence
Deep sequencing56 reads, 6 experiments
Evidence experimental; array-cloned [1], cloned [2]
Predicted targets

References

1
PMID:15965474 "Identification of hundreds of conserved and nonconserved human microRNAs" Bentwich I, Avniel A, Karov Y, Aharonov R, Gilad S, Barad O, Barzilai A, Einat P, Einav U, Meiri E, Sharon E, Spector Y, Bentwich Z Nat Genet. 37:766-770(2005).
2
PMID:17604727 "A mammalian microRNA expression atlas based on small RNA library sequencing" Landgraf P, Rusu M, Sheridan R, Sewer A, Iovino N, Aravin A, Pfeffer S, Rice A, Kamphorst AO, Landthaler M, Lin C, Socci ND, Hermida L, Fulci V, Chiaretti S, Foa R, Schliwka J, Fuchs U, Novosel A, Muller RU, Schermer B, Bissels U, Inman J, Phan Q, Chien M Cell. 129:1401-1414(2007).