|
miRBase |
|
Stem-loop sequence hsa-mir-520b |
|||||
| Accession | MI0003155 | ||||
| Symbol | HGNC:MIR520B | ||||
| Description | Homo sapiens miR-520b stem-loop | ||||
| Gene family | MIPF0000020; mir-515 | ||||
| Stem-loop |
c guug u cccucua agggaagcgcuuucu uc g ||||||| ||||||||||||||| || a gggagau uuccuucgugaaaga ag a u --aa a |
||||
| Deep sequencing |
| ||||
| Genome context |
|
||||
| Clustered miRNAs | |||||
| Database links | |||||
Mature sequence hsa-miR-520b |
|
| Accession | MIMAT0002843 |
| Sequence |
41 - aaagugcuuccuuuuagaggg - 61 |
| Deep sequencing | 12 reads, 3 experiments |
| Evidence | experimental; array-cloned [1] |
| Validated targets |
|
| Predicted targets |
|
References |
|
| 1 |
PMID:15965474
"Identification of hundreds of conserved and nonconserved human microRNAs"
Nat Genet. 37:766-770(2005).
|