Stem-loop sequence hsa-mir-520b

AccessionMI0003155 (change log)
Symbol HGNC:MIR520B
DescriptionHomo sapiens miR-520b stem-loop
Gene family MIPF0000020; mir-515
Literature search

37 open access papers mention hsa-mir-520b
(99 sentences)

Stem-loop
          c               guug  u 
5' cccucua agggaagcgcuuucu    uc g
   ||||||| |||||||||||||||    || a
3' gggagau uuccuucgugaaaga    ag a
          u               --aa  a 
Get sequence
Deep sequencing
747 reads, 9.8 reads per million, 51 experiments
Confidence Annotation confidence: high
Feedback: Do you believe this miRNA is real?
Genome context
Coordinates (GRCh38; GCA_000001405.15) Overlapping transcripts
chr19: 53701227-53701287 [+]
sense
OTTHUMT00000464185 ; CTD-2245F17.3-001; intron 1
OTTHUMT00000464186 ; CTD-2245F17.3-002; intron 1
ENST00000597550 ; CTD-2245F17.3-001; intron 1
ENST00000601072 ; CTD-2245F17.3-002; intron 1
Clustered miRNAs
< 10kb from hsa-mir-520b
hsa-mir-526bchr19: 53694393-53694475 [+]
hsa-mir-519bchr19: 53695213-53695293 [+]
hsa-mir-525chr19: 53697533-53697617 [+]
hsa-mir-523chr19: 53698385-53698471 [+]
hsa-mir-518fchr19: 53700015-53700101 [+]
hsa-mir-520bchr19: 53701227-53701287 [+]
hsa-mir-518bchr19: 53702737-53702819 [+]
hsa-mir-526a-1chr19: 53706252-53706336 [+]
hsa-mir-520cchr19: 53707453-53707539 [+]
hsa-mir-518cchr19: 53708735-53708835 [+]
hsa-mir-524chr19: 53711002-53711088 [+]
Database links

Mature sequence hsa-miR-520b-5p

Accession MIMAT0037325
Sequence

2 - 

ccucuacagggaagcgcuuuc

 - 22

Get sequence
Deep sequencing564 reads, 30 experiments
Evidence experimental; Illumina [2]

Mature sequence hsa-miR-520b-3p

Accession MIMAT0002843
Sequence

41 - 

aaagugcuuccuuuuagaggg

 - 61

Get sequence
Deep sequencing171 reads, 27 experiments
Evidence experimental; array-cloned [1]
Predicted targets

References

1
PMID:15965474 "Identification of hundreds of conserved and nonconserved human microRNAs" Bentwich I, Avniel A, Karov Y, Aharonov R, Gilad S, Barad O, Barzilai A, Einat P, Einav U, Meiri E, Sharon E, Spector Y, Bentwich Z Nat Genet. 37:766-770(2005).
2
PMID:25822230 "Selective microRNA-Offset RNA expression in human embryonic stem cells" Asikainen S, Heikkinen L, Juhila J, Holm F, Weltner J, Trokovic R, Mikkola M, Toivonen S, Balboa D, Lampela R, Icay K, Tuuri T, Otonkoski T, Wong G, Hovatta O PLoS One. 10:e0116668(2015).