Stem-loop sequence hsa-mir-523

AccessionMI0003153 (change log)
Symbol HGNC:MIR523
DescriptionHomo sapiens miR-523 stem-loop
Gene family MIPF0000020; mir-515
Literature search

4 open access papers mention hsa-mir-523
(10 sentences)

Stem-loop
        ugcu           g          u    guug  u 
5' ucuca    gugacccucua agggaagcgc uucu    uc g
   |||||    ||||||||||| |||||||||| ||||    || a
3' agagu    cauugggagau ucccuucgcg aaga    ag a
        uucc           a          c    --aa  a 
Get sequence
Deep sequencing
568 reads, 3.28 reads per million, 61 experiments
Confidence Annotation confidence: high
Feedback: Do you believe this miRNA is real?
Genome context
Coordinates (GRCh38; GCA_000001405.15) Overlapping transcripts
chr19: 53698385-53698471 [+]
intergenic
Clustered miRNAs
< 10kb from hsa-mir-523
hsa-mir-1283-1chr19: 53688481-53688567 [+]
hsa-mir-520achr19: 53690881-53690965 [+]
hsa-mir-526bchr19: 53694393-53694475 [+]
hsa-mir-519bchr19: 53695213-53695293 [+]
hsa-mir-525chr19: 53697533-53697617 [+]
hsa-mir-523chr19: 53698385-53698471 [+]
hsa-mir-518fchr19: 53700015-53700101 [+]
hsa-mir-520bchr19: 53701227-53701287 [+]
hsa-mir-518bchr19: 53702737-53702819 [+]
hsa-mir-526a-1chr19: 53706252-53706336 [+]
hsa-mir-520cchr19: 53707453-53707539 [+]
Database links

Mature sequence hsa-miR-523-5p

Accession MIMAT0005449
Previous IDshsa-miR-523*
Sequence

16 - 

cucuagagggaagcgcuuucug

 - 37

Get sequence
Deep sequencing509 reads, 49 experiments
Evidence experimental; array-cloned [1], cloned [2]
Database links
Predicted targets

Mature sequence hsa-miR-523-3p

Accession MIMAT0002840
Previous IDshsa-miR-523
Sequence

53 - 

gaacgcgcuucccuauagagggu

 - 75

Get sequence
Deep sequencing55 reads, 21 experiments
Evidence experimental; array-cloned [1], cloned [2]
Predicted targets

References

1
PMID:15965474 "Identification of hundreds of conserved and nonconserved human microRNAs" Bentwich I, Avniel A, Karov Y, Aharonov R, Gilad S, Barad O, Barzilai A, Einat P, Einav U, Meiri E, Sharon E, Spector Y, Bentwich Z Nat Genet. 37:766-770(2005).
2
PMID:17604727 "A mammalian microRNA expression atlas based on small RNA library sequencing" Landgraf P, Rusu M, Sheridan R, Sewer A, Iovino N, Aravin A, Pfeffer S, Rice A, Kamphorst AO, Landthaler M, Lin C, Socci ND, Hermida L, Fulci V, Chiaretti S, Foa R, Schliwka J, Fuchs U, Novosel A, Muller RU, Schermer B, Bissels U, Inman J, Phan Q, Chien M Cell. 129:1401-1414(2007).