Stem-loop sequence hsa-mir-525

Accession MI0003152
Symbol HGNC:MIR525
Description Homo sapiens miR-525 stem-loop
Gene family MIPF0000020; mir-515
Stem-loop 
             u   c       u  a      c  aug 
cucaagcugugac cuc agaggga gc cuuucu uu   u
||||||||||||| ||| ||||||| || |||||| ||   g
ggguuuggcauug gag uuucccu cg ggaaga aa   a
             c   a       u  c      a  aaa
Get sequence
Deep sequencing
9 reads, 3 experiments
Comments

The mature products were previously named miR-525 and miR-525* in [1] and here. Landgraf et al. show that both products are significantly expressed, prompting a renaming to miR-525-5p and miR-525-3p [2]. The mature sequence shown here represents the most commonly cloned form from large-scale cloning studies [2].

Genome context
Coordinates (GRCh37.p5) Overlapping transcripts
chr19: 54200787-54200871 [+]
intergenic
Clustered miRNAs
< 10kb from hsa-mir-525
hsa-mir-1283-1 chr19: 54191735-54191821 [+]
hsa-mir-520a chr19: 54194135-54194219 [+]
hsa-mir-526b chr19: 54197647-54197729 [+]
hsa-mir-519b chr19: 54198467-54198547 [+]
hsa-mir-525 chr19: 54200787-54200871 [+]
hsa-mir-523 chr19: 54201639-54201725 [+]
hsa-mir-518f chr19: 54203269-54203355 [+]
hsa-mir-520b chr19: 54204481-54204541 [+]
hsa-mir-518b chr19: 54205991-54206073 [+]
hsa-mir-526a-1 chr19: 54209506-54209590 [+]
hsa-mir-520c chr19: 54210707-54210793 [+]
Database links

Mature sequence hsa-miR-525-5p

Accession MIMAT0002838
Previous IDs hsa-miR-525
Sequence

15 -  

cuccagagggaugcacuuucu

 - 35

Get sequence
Deep sequencing 4 reads, 1 experiments
Evidence experimental; array-cloned [1], cloned [2]
Predicted targets

Mature sequence hsa-miR-525-3p

Accession MIMAT0002839
Previous IDs hsa-miR-525*
Sequence

52 -  

gaaggcgcuucccuuuagagcg

 - 73

Get sequence
Deep sequencing 5 reads, 3 experiments
Evidence experimental; array-cloned [1], cloned [2]
Predicted targets

References

1
PMID:15965474 "Identification of hundreds of conserved and nonconserved human microRNAs" Bentwich I, Avniel A, Karov Y, Aharonov R, Gilad S, Barad O, Barzilai A, Einat P, Einav U, Meiri E, Sharon E, Spector Y, Bentwich Z Nat Genet. 37:766-770(2005).
2
PMID:17604727 "A mammalian microRNA expression atlas based on small RNA library sequencing" Landgraf P, Rusu M, Sheridan R, Sewer A, Iovino N, Aravin A, Pfeffer S, Rice A, Kamphorst AO, Landthaler M, Lin C, Socci ND, Hermida L, Fulci V, Chiaretti S, Foa R, Schliwka J, Fuchs U, Novosel A, Muller RU, Schermer B, Bissels U, Inman J, Phan Q, Chien M Cell. 129:1401-1414(2007).