Stem-loop sequence hsa-mir-526b

AccessionMI0003150 (change log)
Symbol HGNC:MIR526B
DescriptionHomo sapiens miR-526b stem-loop
Gene family MIPF0000020; mir-515
Literature search

15 open access papers mention hsa-mir-526b
(46 sentences)

Stem-loop
         u    c     u                g  g c 
5' ucaggc guga ccucu gagggaagcacuuucu uu u u
   |||||| |||| ||||| |||||||||||||||| || | g
3' agucug cauu ggaga uuuccuucgugaaaga aa a a
         u    c     u                g  g a 
Get sequence
Deep sequencing
684 reads, 1.41 reads per million, 71 experiments
Confidence Annotation confidence: high
Feedback: Do you believe this miRNA is real?
Comments

The mature sequence shown here represents the most commonly cloned form from large-scale cloning studies [2].

Genome context
Coordinates (GRCh38; GCA_000001405.15) Overlapping transcripts
chr19: 53694393-53694475 [+]
antisense
OTTHUMT00000464179 ; ZNF665-002; intron 1
OTTHUMT00000464180 ; ZNF665-001; intron 1
OTTHUMT00000464181 ; ZNF665-005; intron 1
OTTHUMT00000464183 ; ZNF665-003; intron 1
OTTHUMT00000464182 ; ZNF665-004; intron 2
ENST00000600412 ; ZNF665-002; intron 1
ENST00000396424 ; ZNF665-001; intron 1
ENST00000597544 ; ZNF665-005; intron 1
ENST00000598440 ; ZNF665-003; intron 1
ENST00000596373 ; ZNF665-004; intron 2
Clustered miRNAs
< 10kb from hsa-mir-526b
hsa-mir-515-2chr19: 53685009-53685091 [+]
hsa-mir-519cchr19: 53686469-53686555 [+]
hsa-mir-1283-1chr19: 53688481-53688567 [+]
hsa-mir-520achr19: 53690881-53690965 [+]
hsa-mir-526bchr19: 53694393-53694475 [+]
hsa-mir-519bchr19: 53695213-53695293 [+]
hsa-mir-525chr19: 53697533-53697617 [+]
hsa-mir-523chr19: 53698385-53698471 [+]
hsa-mir-518fchr19: 53700015-53700101 [+]
hsa-mir-520bchr19: 53701227-53701287 [+]
hsa-mir-518bchr19: 53702737-53702819 [+]
Database links

Mature sequence hsa-miR-526b-5p

Accession MIMAT0002835
Previous IDshsa-miR-526b
Sequence

14 - 

cucuugagggaagcacuuucugu

 - 36

Get sequence
Deep sequencing89 reads, 41 experiments
Evidence experimental; array-cloned [1], cloned [2]
Predicted targets

Mature sequence hsa-miR-526b-3p

Accession MIMAT0002836
Previous IDshsa-miR-526b*
Sequence

51 - 

gaaagugcuuccuuuuagaggc

 - 72

Get sequence
Deep sequencing580 reads, 44 experiments
Evidence experimental; array-cloned [1], cloned [2]
Predicted targets

References

1
PMID:15965474 "Identification of hundreds of conserved and nonconserved human microRNAs" Bentwich I, Avniel A, Karov Y, Aharonov R, Gilad S, Barad O, Barzilai A, Einat P, Einav U, Meiri E, Sharon E, Spector Y, Bentwich Z Nat Genet. 37:766-770(2005).
2
PMID:17604727 "A mammalian microRNA expression atlas based on small RNA library sequencing" Landgraf P, Rusu M, Sheridan R, Sewer A, Iovino N, Aravin A, Pfeffer S, Rice A, Kamphorst AO, Landthaler M, Lin C, Socci ND, Hermida L, Fulci V, Chiaretti S, Foa R, Schliwka J, Fuchs U, Novosel A, Muller RU, Schermer B, Bissels U, Inman J, Phan Q, Chien M Cell. 129:1401-1414(2007).