Stem-loop sequence hsa-mir-519c

Accession MI0003148
Symbol HGNC:MIR519C
Description Homo sapiens miR-519c stem-loop
Gene family MIPF0000020; mir-515
Stem-loop 
      c      c            a         guug  u 
ucucag cuguga ccucuagaggga gcgcuuucu    uc g
|||||| |||||| |||||||||||| |||||||||    || a
agaguu gacauu ggagauuuuucu cgugaaaga    ag a
      u      a            a         --aa  a
Get sequence
Deep sequencing
12 reads, 2 experiments
Comments

The 5' arm of this precursor expresses a product related to miR-526 (previously named miR-526c here). Landgraf et al. confirm mature miRNA expression from both arms of the precursor [2], leading to the -5p, -3p designations. The mature sequence shown here represents the most commonly cloned form from large-scale cloning studies [2].

Genome context
Coordinates (GRCh37.p5) Overlapping transcripts
chr19: 54189723-54189809 [+]
intergenic
Clustered miRNAs
< 10kb from hsa-mir-519c
hsa-mir-515-1 chr19: 54182257-54182339 [+]
hsa-mir-519e chr19: 54183194-54183277 [+]
hsa-mir-520f chr19: 54185413-54185499 [+]
hsa-mir-515-2 chr19: 54188263-54188345 [+]
hsa-mir-519c chr19: 54189723-54189809 [+]
hsa-mir-1283-1 chr19: 54191735-54191821 [+]
hsa-mir-520a chr19: 54194135-54194219 [+]
hsa-mir-526b chr19: 54197647-54197729 [+]
hsa-mir-519b chr19: 54198467-54198547 [+]
Database links

Mature sequence hsa-miR-519c-5p

Accession MIMAT0002831
Previous IDs hsa-miR-526c
Sequence

16 -  

cucuagagggaagcgcuuucug

 - 37

Get sequence
Deep sequencing 8 reads, 2 experiments
Evidence experimental; array-cloned [1], cloned [2]
Predicted targets

Mature sequence hsa-miR-519c-3p

Accession MIMAT0002832
Previous IDs hsa-miR-519c
Sequence

54 -  

aaagugcaucuuuuuagaggau

 - 75

Get sequence
Deep sequencing 4 reads, 2 experiments
Evidence experimental; array-cloned [1]
Validated targets
Predicted targets

References

1
PMID:15965474 "Identification of hundreds of conserved and nonconserved human microRNAs" Bentwich I, Avniel A, Karov Y, Aharonov R, Gilad S, Barad O, Barzilai A, Einat P, Einav U, Meiri E, Sharon E, Spector Y, Bentwich Z Nat Genet. 37:766-770(2005).
2
PMID:17604727 "A mammalian microRNA expression atlas based on small RNA library sequencing" Landgraf P, Rusu M, Sheridan R, Sewer A, Iovino N, Aravin A, Pfeffer S, Rice A, Kamphorst AO, Landthaler M, Lin C, Socci ND, Hermida L, Fulci V, Chiaretti S, Foa R, Schliwka J, Fuchs U, Novosel A, Muller RU, Schermer B, Bissels U, Inman J, Phan Q, Chien M Cell. 129:1401-1414(2007).