Stem-loop sequence hsa-mir-519e

AccessionMI0003145 (change log)
Symbol HGNC:MIR519E
DescriptionHomo sapiens miR-519e stem-loop
Gene family MIPF0000020; mir-515
Literature search

24 open access papers mention hsa-mir-519e
(62 sentences)

Stem-loop
        u     c  u   c      ga      uc     ga 
5' ucuca gcagu au cuc aaaagg  gcacuu  uguuu  a
   ||||| ||||| || ||| ||||||  ||||||  |||||   
3' agagu uguca ug gag uuuucc  cgugaa  acaaa  a
        u     u  u   a      uc      --     ag 
Get sequence
Deep sequencing
3616 reads, 10.2 reads per million, 49 experiments
Confidence Annotation confidence: not enough data
Feedback: Do you believe this miRNA is real?
Comments

The mature sequence shown here represents the most commonly cloned form from large-scale cloning studies [2]. The 5' end of the miRNA may be offset with respect to previous annotations.

Genome context
Coordinates (GRCh38; GCA_000001405.15) Overlapping transcripts
chr19: 53679940-53680023 [+]
antisense
OTTHUMT00000464179 ; ZNF665-002; intron 1
OTTHUMT00000464180 ; ZNF665-001; intron 2
ENST00000600412 ; ZNF665-002; intron 1
ENST00000396424 ; ZNF665-001; intron 2
Clustered miRNAs
< 10kb from hsa-mir-519e
hsa-mir-1323chr19: 53671968-53672040 [+]
hsa-mir-498chr19: 53674197-53674320 [+]
hsa-mir-520echr19: 53675711-53675797 [+]
hsa-mir-515-1chr19: 53679003-53679085 [+]
hsa-mir-519echr19: 53679940-53680023 [+]
hsa-mir-520fchr19: 53682159-53682245 [+]
hsa-mir-515-2chr19: 53685009-53685091 [+]
hsa-mir-519cchr19: 53686469-53686555 [+]
hsa-mir-1283-1chr19: 53688481-53688567 [+]
Database links

Mature sequence hsa-miR-519e-5p

Accession MIMAT0002828
Previous IDshsa-miR-519e*
Sequence

14 - 

uucuccaaaagggagcacuuuc

 - 35

Get sequence
Deep sequencing9 reads, 6 experiments
Evidence experimental; array-cloned [1]
Predicted targets

Mature sequence hsa-miR-519e-3p

Accession MIMAT0002829
Previous IDshsa-miR-519e
Sequence

52 - 

aagugccuccuuuuagaguguu

 - 73

Get sequence
Deep sequencing3602 reads, 47 experiments
Evidence experimental; array-cloned [1], cloned [2]
Predicted targets

References

1
PMID:15965474 "Identification of hundreds of conserved and nonconserved human microRNAs" Bentwich I, Avniel A, Karov Y, Aharonov R, Gilad S, Barad O, Barzilai A, Einat P, Einav U, Meiri E, Sharon E, Spector Y, Bentwich Z Nat Genet. 37:766-770(2005).
2
PMID:17604727 "A mammalian microRNA expression atlas based on small RNA library sequencing" Landgraf P, Rusu M, Sheridan R, Sewer A, Iovino N, Aravin A, Pfeffer S, Rice A, Kamphorst AO, Landthaler M, Lin C, Socci ND, Hermida L, Fulci V, Chiaretti S, Foa R, Schliwka J, Fuchs U, Novosel A, Muller RU, Schermer B, Bissels U, Inman J, Phan Q, Chien M Cell. 129:1401-1414(2007).