Stem-loop sequence hsa-mir-515-1

AccessionMI0003144 (change log)
Symbol HGNC:MIR515-1
DescriptionHomo sapiens miR-515-1 stem-loop
Gene family MIPF0000020; mir-515
Stem-loop
        u     c  u           a    uu      gu 
5' ucuca gcagu au cuccaaaagaa gcac  ucuguu  c
   ||||| ||||| || ||||||||||| ||||  ||||||  u
3' agagu uguca ug gagguuuucuu cgug  agacga  g
        u     u  c           c    --      aa 
Get sequence
Deep sequencing
37 reads, 28.6 reads per million, 14 experiments
Confidence Annotation confidence: high
Feedback: Do you believe this miRNA is real?
Comments

The mature sequence shown here represents the most commonly cloned form from large-scale cloning studies [2].

Genome context
Coordinates (GRCh38; GCA_000001405.15) Overlapping transcripts
chr19: 53679003-53679085 [+]
antisense
OTTHUMT00000464179 ; ZNF665-002; intron 1
OTTHUMT00000464180 ; ZNF665-001; intron 2
ENST00000600412 ; ZNF665-002; intron 1
ENST00000396424 ; ZNF665-001; intron 2
Clustered miRNAs
< 10kb from hsa-mir-515-1
hsa-mir-512-2chr19: 53669157-53669254 [+]
hsa-mir-1323chr19: 53671968-53672040 [+]
hsa-mir-498chr19: 53674197-53674320 [+]
hsa-mir-520echr19: 53675711-53675797 [+]
hsa-mir-515-1chr19: 53679003-53679085 [+]
hsa-mir-519echr19: 53679940-53680023 [+]
hsa-mir-520fchr19: 53682159-53682245 [+]
hsa-mir-515-2chr19: 53685009-53685091 [+]
hsa-mir-519cchr19: 53686469-53686555 [+]
hsa-mir-1283-1chr19: 53688481-53688567 [+]
Database links

Mature sequence hsa-miR-515-5p

Accession MIMAT0002826
Sequence

14 - 

uucuccaaaagaaagcacuuucug

 - 37

Get sequence
Deep sequencing56 reads, 11 experiments
Evidence experimental; array-cloned [1], cloned [2]
Database links
Predicted targets

Mature sequence hsa-miR-515-3p

Accession MIMAT0002827
Sequence

51 - 

gagugccuucuuuuggagcguu

 - 72

Get sequence
Deep sequencing18 reads, 8 experiments
Evidence experimental; array-cloned [1], cloned [2]
Predicted targets

References

1
PMID:15965474 "Identification of hundreds of conserved and nonconserved human microRNAs" Bentwich I, Avniel A, Karov Y, Aharonov R, Gilad S, Barad O, Barzilai A, Einat P, Einav U, Meiri E, Sharon E, Spector Y, Bentwich Z Nat Genet. 37:766-770(2005).
2
PMID:17604727 "A mammalian microRNA expression atlas based on small RNA library sequencing" Landgraf P, Rusu M, Sheridan R, Sewer A, Iovino N, Aravin A, Pfeffer S, Rice A, Kamphorst AO, Landthaler M, Lin C, Socci ND, Hermida L, Fulci V, Chiaretti S, Foa R, Schliwka J, Fuchs U, Novosel A, Muller RU, Schermer B, Bissels U, Inman J, Phan Q, Chien M Cell. 129:1401-1414(2007).