Stem-loop sequence hsa-mir-520e

AccessionMI0003143 (change log)
Symbol HGNC:MIR520E
DescriptionHomo sapiens miR-520e stem-loop
Gene family MIPF0000020; mir-515
Literature search

40 open access papers mention hsa-mir-520e
(95 sentences)

Stem-loop
       cu  u             u       g     guug   g 
5' ucuc  gc gugacccucaaga ggaagca uuucu    ucu a
   ||||  || ||||||||||||| ||||||| |||||    |||  
3' agag  ug cauugggaguuuu ccuucgu aaaga    agg a
       uu  u             u       g     ---a   a 
Get sequence
Deep sequencing
1524 reads, 33.3 reads per million, 36 experiments
Confidence Annotation confidence: not enough data
Feedback: Do you believe this miRNA is real?
Genome context
Coordinates (GRCh38; GCA_000001405.15) Overlapping transcripts
chr19: 53675711-53675797 [+]
antisense
OTTHUMT00000464179 ; ZNF665-002; intron 1
OTTHUMT00000464180 ; ZNF665-001; intron 3
ENST00000600412 ; ZNF665-002; intron 1
ENST00000396424 ; ZNF665-001; intron 3
Clustered miRNAs
< 10kb from hsa-mir-520e
hsa-mir-512-1chr19: 53666679-53666762 [+]
hsa-mir-512-2chr19: 53669157-53669254 [+]
hsa-mir-1323chr19: 53671968-53672040 [+]
hsa-mir-498chr19: 53674197-53674320 [+]
hsa-mir-520echr19: 53675711-53675797 [+]
hsa-mir-515-1chr19: 53679003-53679085 [+]
hsa-mir-519echr19: 53679940-53680023 [+]
hsa-mir-520fchr19: 53682159-53682245 [+]
hsa-mir-515-2chr19: 53685009-53685091 [+]
Database links

Mature sequence hsa-miR-520e-5p

Accession MIMAT0037324
Sequence

16 - 

cucaagauggaagcaguuucug

 - 37

Get sequence
Deep sequencing5 reads, 3 experiments
Evidence experimental; Illumina [2]

Mature sequence hsa-miR-520e-3p

Accession MIMAT0002825
Sequence

54 - 

aaagugcuuccuuuuugaggg

 - 74

Get sequence
Deep sequencing1510 reads, 42 experiments
Evidence experimental; array-cloned [1]
Predicted targets

References

1
PMID:15965474 "Identification of hundreds of conserved and nonconserved human microRNAs" Bentwich I, Avniel A, Karov Y, Aharonov R, Gilad S, Barad O, Barzilai A, Einat P, Einav U, Meiri E, Sharon E, Spector Y, Bentwich Z Nat Genet. 37:766-770(2005).
2
PMID:25822230 "Selective microRNA-Offset RNA expression in human embryonic stem cells" Asikainen S, Heikkinen L, Juhila J, Holm F, Weltner J, Trokovic R, Mikkola M, Toivonen S, Balboa D, Lampela R, Icay K, Tuuri T, Otonkoski T, Wong G, Hovatta O PLoS One. 10:e0116668(2015).