Stem-loop sequence hsa-mir-512-1

AccessionMI0003140
Symbol HGNC:MIR512-1
DescriptionHomo sapiens miR-512-1 stem-loop
Gene family MIPF0000130; mir-506
Stem-loop
   u       ug   ca      cu   g       ----    g 
5'  cucaguc  ugg  cucagc  uga ggcacuu    ucug u
    |||||||  |||  ||||||  ||| |||||||    ||||  
3'  gagucag  acc  gagucg  acu ucgugaa    agac g
   g       ua   ug      au   g       agua    c 
Get sequence
Deep sequencing
41 reads, 72.6 reads per million, 10 experiments
Confidence
Feedback: Do you believe this miRNA is real?
Genome context
Coordinates (GRCh38) Overlapping transcripts
chr19: 53666679-53666762 [+]
sense
OTTHUMT00000464184 ; CTD-2245F17.2-001; exon 2
ENST00000600257 ; CTD-2245F17.2-001; exon 2
antisense
OTTHUMT00000464177 ; ZNF665-007; intron 1
ENST00000596564 ; ZNF665-007; intron 1
Clustered miRNAs
< 10kb from hsa-mir-512-1
hsa-mir-512-1chr19: 53666679-53666762 [+]
hsa-mir-512-2chr19: 53669157-53669254 [+]
hsa-mir-1323chr19: 53671968-53672040 [+]
hsa-mir-498chr19: 53674197-53674320 [+]
hsa-mir-520echr19: 53675711-53675797 [+]
Database links

Mature sequence hsa-miR-512-5p

Accession MIMAT0002822
Sequence

14 - 

cacucagccuugagggcacuuuc

 - 36

Get sequence
Deep sequencing10 reads, 4 experiments
Evidence experimental; array-cloned [1]
Validated targets
Predicted targets

Mature sequence hsa-miR-512-3p

Accession MIMAT0002823
Sequence

51 - 

aagugcugucauagcugagguc

 - 72

Get sequence
Deep sequencing16 reads, 2 experiments
Evidence experimental; array-cloned [1], cloned [2]
Validated targets
Predicted targets

References

1
PMID:15965474 "Identification of hundreds of conserved and nonconserved human microRNAs" Bentwich I, Avniel A, Karov Y, Aharonov R, Gilad S, Barad O, Barzilai A, Einat P, Einav U, Meiri E, Sharon E, Spector Y, Bentwich Z Nat Genet. 37:766-770(2005).
2
PMID:17604727 "A mammalian microRNA expression atlas based on small RNA library sequencing" Landgraf P, Rusu M, Sheridan R, Sewer A, Iovino N, Aravin A, Pfeffer S, Rice A, Kamphorst AO, Landthaler M, Lin C, Socci ND, Hermida L, Fulci V, Chiaretti S, Foa R, Schliwka J, Fuchs U, Novosel A, Muller RU, Schermer B, Bissels U, Inman J, Phan Q, Chien M Cell. 129:1401-1414(2007).