Stem-loop sequence hsa-mir-181d

Accession MI0003139
Symbol HGNC:MIR181D
Description Homo sapiens miR-181d stem-loop
Gene family MIPF0000007; mir-181
Community annotation

This text is a summary paragraph taken from the Wikipedia entry entitled mir-181_microRNA_precursor. miRBase and Rfam are facilitating community annotation of microRNA families and entries in Wikipedia. Read more ...

In molecular biology miR-181 microRNA precursor is a small non-coding RNA molecule. MicroRNAs (miRNAs) are transcribed as ~70 nucleotide precursors and subsequently processed by the RNase-III type enzyme Dicer to give a ~22 nucleotide mature product. In this case the mature sequence comes from the 5' arm of the precursor. They target and modulate protein expression by inhibiting translation and / or inducing degradation of target messenger RNAs. This new class of genes has recently been shown to play a central role in malignant transformation. miRNA are downregulated in many tumors and thus appear to function as tumor suppressor genes. The mature products miR-181a, miR-181b, miR-181c or miR-181d are thought to have regulatory roles at posttranscriptional level, through complementarity to target mRNAs. miR-181 which has been predicted or experimentally confirmed in a wide number of vertebrate species as rat, zebrafish, and in the pufferfish (see below) (MIPF0000007).

Show Wikipedia entry View @ Wikipedia Edit Wikipedia entry
Stem-loop
      --      -     ----aca   ga       auca         g ug          guga  a u 
gucccc  uccccu aggcc       gcc  ggucaca    acauucauu u  ucgguggguu    gg c g
||||||  |||||| |||||       |||  |||||||    ||||||||| |  ||||||||||    || |  
cagggg  agggga uucgg       cgg  ucggugu    uguaaguag g  ggccacccag    cc g a
      ua      a     cacagac   -g       -cac         g --          ---a  - g 
Get sequence
Deep sequencing
24573 reads, 20 experiments
Comments

The mature sequence shown here represents the most commonly cloned form from large-scale cloning studies [2].

Genome context
Coordinates (GRCh37.p5) Overlapping transcripts
chr19: 13985689-13985825 [+]
intergenic
Clustered miRNAs
< 10kb from hsa-mir-181d
hsa-mir-181c chr19: 13985513-13985622 [+]
hsa-mir-181d chr19: 13985689-13985825 [+]
Database links

Mature sequence hsa-miR-181d

Accession MIMAT0002821
Sequence

36 - 

aacauucauuguugucggugggu

 - 58

Get sequence
Deep sequencing 24570 reads, 18 experiments
Evidence experimental; array-cloned [1], cloned [2]
Validated targets
Predicted targets

References

1
PMID:15965474 "Identification of hundreds of conserved and nonconserved human microRNAs" Bentwich I, Avniel A, Karov Y, Aharonov R, Gilad S, Barad O, Barzilai A, Einat P, Einav U, Meiri E, Sharon E, Spector Y, Bentwich Z Nat Genet. 37:766-770(2005).
2
PMID:17604727 "A mammalian microRNA expression atlas based on small RNA library sequencing" Landgraf P, Rusu M, Sheridan R, Sewer A, Iovino N, Aravin A, Pfeffer S, Rice A, Kamphorst AO, Landthaler M, Lin C, Socci ND, Hermida L, Fulci V, Chiaretti S, Foa R, Schliwka J, Fuchs U, Novosel A, Muller RU, Schermer B, Bissels U, Inman J, Phan Q, Chien M Cell. 129:1401-1414(2007).