Stem-loop sequence hsa-mir-497

AccessionMI0003138
Symbol HGNC:MIR497
DescriptionHomo sapiens miR-497 stem-loop
Gene family MIPF0000231; mir-497
Stem-loop
     a cc    -   g         - -----    g    c         u  --   ac 
5' cc c  cggu ccu cucccgccc c     agca caca ugugguuug ac  ggc  u
   || |  |||| ||| ||||||||| |     |||| |||| ||||||||| ||  |||   
3' gg g  gcca gga ggggguggg g     uugu gugu acaccaaac ug  ccg  g
     a cc    c   -         a cgaga    g    c         c  ca   gu 
Get sequence
Deep sequencing
4833 reads, 1.35e+03 reads per million, 71 experiments
Confidence Annotation confidence: high
Feedback: Do you believe this miRNA is real?
Genome context
Coordinates (GRCh38) Overlapping transcripts
chr17: 7017911-7018022 [-]
sense
OTTHUMT00000220003 ; ASGR2-002; intron 1
OTTHUMT00000220002 ; ASGR2-001; intron 1
OTTHUMT00000439920 ; ASGR2-005; intron 1
OTTHUMT00000439921 ; ASGR2-006; intron 2
OTTHUMT00000439938 ; ASGR2-007; intron 3
ENST00000355035 ; ASGR2-002; intron 1
ENST00000254850 ; ASGR2-001; intron 1
ENST00000576487 ; ASGR2-005; intron 1
ENST00000380952 ; ASGR2-201; intron 1
ENST00000450034 ; ASGR2-006; intron 2
ENST00000574868 ; ASGR2-007; intron 3
Clustered miRNAs
< 10kb from hsa-mir-497
hsa-mir-497chr17: 7017911-7018022 [-]
hsa-mir-195chr17: 7017615-7017701 [-]
Database links

Mature sequence hsa-miR-497-5p

Accession MIMAT0002820
Previous IDshsa-miR-497
Sequence

24 - 

cagcagcacacugugguuugu

 - 44

Get sequence
Deep sequencing918 reads, 65 experiments
Evidence experimental; array-cloned [1], cloned [2]
Validated targets
Predicted targets

Mature sequence hsa-miR-497-3p

Accession MIMAT0004768
Previous IDshsa-miR-497*
Sequence

64 - 

caaaccacacugugguguuaga

 - 85

Get sequence
Deep sequencing151 reads, 22 experiments
Evidence experimental; cloned [2]
Predicted targets

References

1
PMID:15965474 "Identification of hundreds of conserved and nonconserved human microRNAs" Bentwich I, Avniel A, Karov Y, Aharonov R, Gilad S, Barad O, Barzilai A, Einat P, Einav U, Meiri E, Sharon E, Spector Y, Bentwich Z Nat Genet. 37:766-770(2005).
2
PMID:17604727 "A mammalian microRNA expression atlas based on small RNA library sequencing" Landgraf P, Rusu M, Sheridan R, Sewer A, Iovino N, Aravin A, Pfeffer S, Rice A, Kamphorst AO, Landthaler M, Lin C, Socci ND, Hermida L, Fulci V, Chiaretti S, Foa R, Schliwka J, Fuchs U, Novosel A, Muller RU, Schermer B, Bissels U, Inman J, Phan Q, Chien M Cell. 129:1401-1414(2007).