Stem-loop sequence hsa-mir-193b

AccessionMI0003137 (change log)
Symbol HGNC:MIR193B
DescriptionHomo sapiens miR-193b stem-loop
Gene family MIPF0000082; mir-193
Stem-loop
      gu       u    gu         g  a  ag uua 
5' gug  cucagaa cggg  uuugagggc ag ug  u   u
   |||  ||||||| ||||  ||||||||| || ||  |   g
3' uac  ggguuuu gccc  aaacucccg uc ac  a   u
      ug       c    ug         g  a  cu uuu 
Get sequence
Deep sequencing
114559 reads, 1.17e+03 reads per million, 77 experiments
Confidence Annotation confidence: high
Feedback: Do you believe this miRNA is real?
Comments

The mature sequence shown here represents the most commonly cloned form from large-scale cloning studies [3].

Genome context
Coordinates (GRCh38; GCA_000001405.15) Overlapping transcripts
chr16: 14303967-14304049 [+]
sense
OTTHUMT00000436626 ; MKL2-011; intron 1
OTTHUMT00000436627 ; MKL2-004; intron 1
OTTHUMT00000436628 ; MKL2-005; intron 1
OTTHUMT00000436621 ; MKL2-001; intron 3
OTTHUMT00000436622 ; MKL2-002; intron 3
OTTHUMT00000436619 ; MKL2-007; intron 4
ENST00000575768 ; MKL2-011; intron 1
ENST00000572567 ; MKL2-004; intron 1
ENST00000573051 ; MKL2-005; intron 1
ENST00000341243 ; MKL2-202; intron 1
ENST00000318282 ; MKL2-201; intron 2
ENST00000571589 ; MKL2-001; intron 3
ENST00000574045 ; MKL2-002; intron 3
ENST00000574998 ; MKL2-007; intron 4
Clustered miRNAs
< 10kb from hsa-mir-193b
hsa-mir-193bchr16: 14303967-14304049 [+]
hsa-mir-365achr16: 14309285-14309371 [+]
Database links

Mature sequence hsa-miR-193b-5p

Accession MIMAT0004767
Previous IDshsa-miR-193b*
Sequence

14 - 

cgggguuuugagggcgagauga

 - 35

Get sequence
Deep sequencing25752 reads, 75 experiments
Evidence experimental; cloned [3-4]
Database links
Predicted targets

Mature sequence hsa-miR-193b-3p

Accession MIMAT0002819
Previous IDshsa-miR-193b
Sequence

51 - 

aacuggcccucaaagucccgcu

 - 72

Get sequence
Deep sequencing88803 reads, 76 experiments
Evidence experimental; array-cloned [1], cloned [2-4]
Database links
Predicted targets

References

1
PMID:15965474 "Identification of hundreds of conserved and nonconserved human microRNAs" Bentwich I, Avniel A, Karov Y, Aharonov R, Gilad S, Barad O, Barzilai A, Einat P, Einav U, Meiri E, Sharon E, Spector Y, Bentwich Z Nat Genet. 37:766-770(2005).
2
PMID:16274478 "Identification of clustered microRNAs using an ab initio prediction method" Sewer A, Paul N, Landgraf P, Aravin A, Pfeffer S, Brownstein MJ, Tuschl T, van Nimwegen E, Zavolan M BMC Bioinformatics. 6:267(2005).
3
PMID:17604727 "A mammalian microRNA expression atlas based on small RNA library sequencing" Landgraf P, Rusu M, Sheridan R, Sewer A, Iovino N, Aravin A, Pfeffer S, Rice A, Kamphorst AO, Landthaler M, Lin C, Socci ND, Hermida L, Fulci V, Chiaretti S, Foa R, Schliwka J, Fuchs U, Novosel A, Muller RU, Schermer B, Bissels U, Inman J, Phan Q, Chien M Cell. 129:1401-1414(2007).
4
PMID:17616659 "Patterns of known and novel small RNAs in human cervical cancer" Lui WO, Pourmand N, Patterson BK, Fire A Cancer Res. 67:6031-6043(2007).