Stem-loop sequence hsa-mir-495

AccessionMI0003135 (change log)
Symbol HGNC:MIR495
DescriptionHomo sapiens miR-495 stem-loop
Gene family MIPF0000110; mir-329
Literature search

50 open access papers mention hsa-mir-495
(177 sentences)

Stem-loop
   u      u          u  -       au     - uuu 
5'  gguacc gaaaagaagu gc ccauguu  uuucg c   a
    |||||| |||||||||| || |||||||  ||||| |   u
3'  cuaugg uuuuucuuca cg gguacaa  aaagc g   a
   a      c          -  u       ac     a ugu 
Get sequence
Deep sequencing
20509 reads, 91.3 reads per million, 127 experiments
Confidence Annotation confidence: high
Feedback: Do you believe this miRNA is real?
Genome context
Coordinates (GRCh38; GCA_000001405.15) Overlapping transcripts
chr14: 101033755-101033836 [+]
antisense
OTTHUMT00000414334 ; BEGAIN-007; intron 1
OTTHUMT00000414329 ; BEGAIN-001; intron 2
OTTHUMT00000414331 ; BEGAIN-005; intron 2
OTTHUMT00000414332 ; BEGAIN-003; intron 2
OTTHUMT00000414335 ; BEGAIN-006; intron 2
OTTHUMT00000414337 ; BEGAIN-004; intron 2
ENST00000557378 ; BEGAIN-007; intron 1
ENST00000443071 ; BEGAIN-201; intron 1
ENST00000355173 ; BEGAIN-001; intron 2
ENST00000553553 ; BEGAIN-005; intron 2
ENST00000556188 ; BEGAIN-003; intron 2
ENST00000554140 ; BEGAIN-006; intron 2
ENST00000554747 ; BEGAIN-004; intron 2
Clustered miRNAs
< 10kb from hsa-mir-495
hsa-mir-299chr14: 101023794-101023856 [+]
hsa-mir-380chr14: 101025017-101025077 [+]
hsa-mir-1197chr14: 101025564-101025651 [+]
hsa-mir-323achr14: 101025732-101025817 [+]
hsa-mir-758chr14: 101026020-101026107 [+]
hsa-mir-329-1chr14: 101026785-101026864 [+]
hsa-mir-329-2chr14: 101027100-101027183 [+]
hsa-mir-494chr14: 101029634-101029714 [+]
hsa-mir-1193chr14: 101030052-101030129 [+]
hsa-mir-543chr14: 101031987-101032064 [+]
hsa-mir-495chr14: 101033755-101033836 [+]
hsa-mir-376cchr14: 101039690-101039755 [+]
hsa-mir-376a-2chr14: 101040069-101040148 [+]
hsa-mir-654chr14: 101040219-101040299 [+]
hsa-mir-376bchr14: 101040436-101040535 [+]
hsa-mir-376a-1chr14: 101040782-101040849 [+]
hsa-mir-300chr14: 101041363-101041445 [+]
hsa-mir-1185-1chr14: 101042977-101043062 [+]
Database links

Mature sequence hsa-miR-495-5p

Accession MIMAT0022924
Sequence

14 - 

gaaguugcccauguuauuuucg

 - 35

Get sequence
Deep sequencing235 reads, 66 experiments
Evidence experimental; SOLiD [3]
Database links
Predicted targets

Mature sequence hsa-miR-495-3p

Accession MIMAT0002817
Previous IDshsa-miR-495
Sequence

50 - 

aaacaaacauggugcacuucuu

 - 71

Get sequence
Deep sequencing20270 reads, 127 experiments
Evidence experimental; array-cloned [1], cloned [2], SOLiD [3]
Database links
Predicted targets

References

1
PMID:15965474 "Identification of hundreds of conserved and nonconserved human microRNAs" Bentwich I, Avniel A, Karov Y, Aharonov R, Gilad S, Barad O, Barzilai A, Einat P, Einav U, Meiri E, Sharon E, Spector Y, Bentwich Z Nat Genet. 37:766-770(2005).
2
PMID:17604727 "A mammalian microRNA expression atlas based on small RNA library sequencing" Landgraf P, Rusu M, Sheridan R, Sewer A, Iovino N, Aravin A, Pfeffer S, Rice A, Kamphorst AO, Landthaler M, Lin C, Socci ND, Hermida L, Fulci V, Chiaretti S, Foa R, Schliwka J, Fuchs U, Novosel A, Muller RU, Schermer B, Bissels U, Inman J, Phan Q, Chien M Cell. 129:1401-1414(2007).
3
PMID:22282338 "Deep-sequencing of endothelial cells exposed to hypoxia reveals the complexity of known and novel microRNAs" Voellenkle C, Rooij Jv, Guffanti A, Brini E, Fasanaro P, Isaia E, Croft L, David M, Capogrossi MC, Moles A, Felsani A, Martelli F RNA. 18:472-484(2012).