|
miRBase |
|
Mature sequence hsa-miR-495-5p |
|
| Accession | MIMAT0022924 |
| Sequence |
14 - gaaguugcccauguuauuuucg - 35 |
| Deep sequencing | 13 reads, 4 experiments |
| Evidence | experimental; SOLiD [3] |
Mature sequence hsa-miR-495-3p |
|
| Accession | MIMAT0002817 |
| Previous IDs | hsa-miR-495 |
| Sequence |
50 - aaacaaacauggugcacuucuu - 71 |
| Deep sequencing | 1457 reads, 10 experiments |
| Evidence | experimental; array-cloned [1], cloned [2], SOLiD [3] |
| Predicted targets |
|
References |
|
| 1 |
PMID:15965474
"Identification of hundreds of conserved and nonconserved human microRNAs"
Nat Genet. 37:766-770(2005).
|
| 2 |
PMID:17604727
"A mammalian microRNA expression atlas based on small RNA library sequencing"
Cell. 129:1401-1414(2007).
|
| 3 | |