Stem-loop sequence hsa-mir-494

Accession MI0003134
Symbol HGNC:MIR494
Description Homo sapiens miR-494 stem-loop
Gene family MIPF0000018; mir-154
Stem-loop
      c            gu      -   c   -  uuu 
gauacu gaaggagagguu  ccgugu ugu uuc uc   a
|||||| ||||||||||||  |||||| ||| ||| ||   u
cuauga uuuuuucuccaa  ggcaca aca aag ag   u
      -            ag      u   -   u  uau 
Get sequence
Deep sequencing
285 reads, 224 reads per million, 36 experiments
Confidence
Feedback: Do you believe this miRNA is real?
Comments

The mature sequence shown here represents the most commonly cloned form from large-scale cloning studies [3].

Genome context
Coordinates (GRCh37.p5) Overlapping transcripts
chr14: 101495971-101496051 [+]
intergenic
Clustered miRNAs
< 10kb from hsa-mir-494
hsa-mir-379 chr14: 101488403-101488469 [+]
hsa-mir-411 chr14: 101489662-101489757 [+]
hsa-mir-299 chr14: 101490131-101490193 [+]
hsa-mir-380 chr14: 101491354-101491414 [+]
hsa-mir-1197 chr14: 101491901-101491988 [+]
hsa-mir-323a chr14: 101492069-101492154 [+]
hsa-mir-758 chr14: 101492357-101492444 [+]
hsa-mir-329-1 chr14: 101493122-101493201 [+]
hsa-mir-329-2 chr14: 101493437-101493520 [+]
hsa-mir-494 chr14: 101495971-101496051 [+]
hsa-mir-1193 chr14: 101496389-101496466 [+]
hsa-mir-543 chr14: 101498324-101498401 [+]
hsa-mir-495 chr14: 101500092-101500173 [+]
Database links

Mature sequence hsa-miR-494-5p

Accession MIMAT0026607
Sequence

15 - 

agguuguccguguugucuucucu

 - 37

Get sequence
Deep sequencing 12 reads, 3 experiments
Evidence experimental; Solexa [23034410]

Mature sequence hsa-miR-494-3p

Accession MIMAT0002816
Sequence

48 - 

ugaaacauacacgggaaaccuc

 - 69

Get sequence
Deep sequencing 271 reads, 35 experiments
Evidence experimental; array-cloned [15965474], cloned [16274478,17604727], Solexa [23034410]
Validated targets
Predicted targets

References

1
PMID:15965474 "Identification of hundreds of conserved and nonconserved human microRNAs" Bentwich I, Avniel A, Karov Y, Aharonov R, Gilad S, Barad O, Barzilai A, Einat P, Einav U, Meiri E, Sharon E, Spector Y, Bentwich Z Nat Genet. 37:766-770(2005).
2
PMID:16274478 "Identification of clustered microRNAs using an ab initio prediction method" Sewer A, Paul N, Landgraf P, Aravin A, Pfeffer S, Brownstein MJ, Tuschl T, van Nimwegen E, Zavolan M BMC Bioinformatics. 6:267(2005).
3
PMID:17604727 "A mammalian microRNA expression atlas based on small RNA library sequencing" Landgraf P, Rusu M, Sheridan R, Sewer A, Iovino N, Aravin A, Pfeffer S, Rice A, Kamphorst AO, Landthaler M, Lin C, Socci ND, Hermida L, Fulci V, Chiaretti S, Foa R, Schliwka J, Fuchs U, Novosel A, Muller RU, Schermer B, Bissels U, Inman J, Phan Q, Chien M Cell. 129:1401-1414(2007).
4
PMID:23034410 "Birth and expression evolution of mammalian microRNA genes" Meunier J, Lemoine F, Soumillon M, Liechti A, Weier M, Guschanski K, Hu H, Khaitovich P, Kaessmann H Genome Res. 23:34-45(2013).