|
miRBase |
|
Stem-loop sequence hsa-mir-494 |
|||||
| Accession | MI0003134 | ||||
| Symbol | HGNC:MIR494 | ||||
| Description | Homo sapiens miR-494 stem-loop | ||||
| Gene family | MIPF0000018; mir-154 | ||||
| Stem-loop |
c gu - c - uuu gauacu gaaggagagguu ccgugu ugu uuc uc a |||||| |||||||||||| |||||| ||| ||| || u cuauga uuuuuucuccaa ggcaca aca aag ag u - ag u - u uau |
||||
| Deep sequencing |
| ||||
| Comments |
The mature sequence shown here represents the most commonly cloned form from large-scale cloning studies [3]. |
||||
| Genome context |
|
||||
| Clustered miRNAs | |||||
| Database links | |||||
Mature sequence hsa-miR-494 |
|
| Accession | MIMAT0002816 |
| Sequence |
48 - ugaaacauacacgggaaaccuc - 69 |
| Deep sequencing | 231 reads, 5 experiments |
| Evidence | experimental; array-cloned [1], cloned [2-3] |
| Validated targets |
|
| Predicted targets |
|
References |
|
| 1 |
PMID:15965474
"Identification of hundreds of conserved and nonconserved human microRNAs"
Nat Genet. 37:766-770(2005).
|
| 2 |
PMID:16274478
"Identification of clustered microRNAs using an ab initio prediction method"
BMC Bioinformatics. 6:267(2005).
|
| 3 |
PMID:17604727
"A mammalian microRNA expression atlas based on small RNA library sequencing"
Cell. 129:1401-1414(2007).
|