Stem-loop sequence hsa-mir-494

AccessionMI0003134
Symbol HGNC:MIR494
DescriptionHomo sapiens miR-494 stem-loop
Gene family MIPF0000018; mir-154
Stem-loop
      c            gu      -   c   -  uuu 
gauacu gaaggagagguu  ccgugu ugu uuc uc   a
|||||| ||||||||||||  |||||| ||| ||| ||   u
cuauga uuuuuucuccaa  ggcaca aca aag ag   u
      -            ag      u   -   u  uau 
Get sequence
Deep sequencing
861 reads, 214 reads per million, 40 experiments
Confidence Annotation confidence: high
Feedback: Do you believe this miRNA is real?
Comments

The mature sequence shown here represents the most commonly cloned form from large-scale cloning studies [3].

Genome context
Coordinates (GRCh38) Overlapping transcripts
chr14: 101029634-101029714 [+]
antisense
OTTHUMT00000414334 ; BEGAIN-007; intron 1
OTTHUMT00000414329 ; BEGAIN-001; intron 2
OTTHUMT00000414331 ; BEGAIN-005; intron 2
OTTHUMT00000414332 ; BEGAIN-003; intron 2
OTTHUMT00000414335 ; BEGAIN-006; intron 2
OTTHUMT00000414337 ; BEGAIN-004; intron 2
ENST00000557378 ; BEGAIN-007; intron 1
ENST00000443071 ; BEGAIN-201; intron 1
ENST00000355173 ; BEGAIN-001; intron 2
ENST00000553553 ; BEGAIN-005; intron 2
ENST00000556188 ; BEGAIN-003; intron 2
ENST00000554140 ; BEGAIN-006; intron 2
ENST00000554747 ; BEGAIN-004; intron 2
Clustered miRNAs
< 10kb from hsa-mir-494
hsa-mir-379chr14: 101022066-101022132 [+]
hsa-mir-411chr14: 101023325-101023420 [+]
hsa-mir-299chr14: 101023794-101023856 [+]
hsa-mir-380chr14: 101025017-101025077 [+]
hsa-mir-1197chr14: 101025564-101025651 [+]
hsa-mir-323achr14: 101025732-101025817 [+]
hsa-mir-758chr14: 101026020-101026107 [+]
hsa-mir-329-1chr14: 101026785-101026864 [+]
hsa-mir-329-2chr14: 101027100-101027183 [+]
hsa-mir-494chr14: 101029634-101029714 [+]
hsa-mir-1193chr14: 101030052-101030129 [+]
hsa-mir-543chr14: 101031987-101032064 [+]
hsa-mir-495chr14: 101033755-101033836 [+]
Database links

Mature sequence hsa-miR-494-5p

Accession MIMAT0026607
Sequence

15 - 

agguuguccguguugucuucucu

 - 37

Get sequence
Deep sequencing8 reads, 2 experiments
Evidence experimental; Illumina [4]

Mature sequence hsa-miR-494-3p

Accession MIMAT0002816
Sequence

48 - 

ugaaacauacacgggaaaccuc

 - 69

Get sequence
Deep sequencing153 reads, 31 experiments
Evidence experimental; array-cloned [1], cloned [2-3], Illumina [4]
Validated targets
Predicted targets

References

1
PMID:15965474 "Identification of hundreds of conserved and nonconserved human microRNAs" Bentwich I, Avniel A, Karov Y, Aharonov R, Gilad S, Barad O, Barzilai A, Einat P, Einav U, Meiri E, Sharon E, Spector Y, Bentwich Z Nat Genet. 37:766-770(2005).
2
PMID:16274478 "Identification of clustered microRNAs using an ab initio prediction method" Sewer A, Paul N, Landgraf P, Aravin A, Pfeffer S, Brownstein MJ, Tuschl T, van Nimwegen E, Zavolan M BMC Bioinformatics. 6:267(2005).
3
PMID:17604727 "A mammalian microRNA expression atlas based on small RNA library sequencing" Landgraf P, Rusu M, Sheridan R, Sewer A, Iovino N, Aravin A, Pfeffer S, Rice A, Kamphorst AO, Landthaler M, Lin C, Socci ND, Hermida L, Fulci V, Chiaretti S, Foa R, Schliwka J, Fuchs U, Novosel A, Muller RU, Schermer B, Bissels U, Inman J, Phan Q, Chien M Cell. 129:1401-1414(2007).
4
PMID:23034410 "Birth and expression evolution of mammalian microRNA genes" Meunier J, Lemoine F, Soumillon M, Liechti A, Weier M, Guschanski K, Hu H, Khaitovich P, Kaessmann H Genome Res. 23:34-45(2013).