|
miRBase |
|
Stem-loop sequence hsa-mir-432 |
|||||
| Accession | MI0003133 | ||||
| Symbol | HGNC:MIR432 | ||||
| Description | Homo sapiens miR-432 stem-loop | ||||
| Gene family | MIPF0000211; mir-432 | ||||
| Stem-loop |
u - c u u ua g a u - uu ga cu cuccagg c uggag ggucauu ggugg ucc c ua u || || ||||||| | ||||| ||||||| ||||| ||| | || cu ga gagguuc g accuc ucgguag ucacc ggg g au c a a u u u -c g - u c uc |
||||
| Deep sequencing |
| ||||
| Genome context |
|
||||
| Clustered miRNAs | |||||
| Database links | |||||
Mature sequence hsa-miR-432-5p |
|
| Accession | MIMAT0002814 |
| Previous IDs | hsa-miR-432 |
| Sequence |
14 - ucuuggaguaggucauugggugg - 36 |
| Deep sequencing | 1997 reads, 10 experiments |
| Evidence | experimental; array-cloned [1], cloned [2-3] |
| Predicted targets |
|
Mature sequence hsa-miR-432-3p |
|
| Accession | MIMAT0002815 |
| Previous IDs | hsa-miR-432* |
| Sequence |
62 - cuggauggcuccuccaugucu - 82 |
| Evidence | experimental; array-cloned [1] |
| Predicted targets |
|
References |
|
| 1 |
PMID:15965474
"Identification of hundreds of conserved and nonconserved human microRNAs"
Nat Genet. 37:766-770(2005).
|
| 2 |
PMID:16274478
"Identification of clustered microRNAs using an ab initio prediction method"
BMC Bioinformatics. 6:267(2005).
|
| 3 |
PMID:17604727
"A mammalian microRNA expression atlas based on small RNA library sequencing"
Cell. 129:1401-1414(2007).
|