Stem-loop sequence hsa-mir-432

AccessionMI0003133 (change log)
Symbol HGNC:MIR432
DescriptionHomo sapiens miR-432 stem-loop
Gene family MIPF0000211; mir-432
Literature search

42 open access papers mention hsa-mir-432
(380 sentences)

Stem-loop
   u  -  c       u u     ua       g     a   u -  uu 
5'  ga cu cuccagg c uggag  ggucauu ggugg ucc c ua  u
    || || ||||||| | |||||  ||||||| ||||| ||| | ||   
3'  cu ga gagguuc g accuc  ucgguag ucacc ggg g au  c
   a  a  u       u u     -c       g     -   u c  uc 
Get sequence
Deep sequencing
28148 reads, 55.6 reads per million, 126 experiments
Confidence Annotation confidence: not enough data
Feedback: Do you believe this miRNA is real?
Genome context
Coordinates (GRCh38; GCA_000001405.15) Overlapping transcripts
chr14: 100884483-100884576 [+]
sense
OTTHUMT00000414309 ; WDR25-007; intron 1
OTTHUMT00000414313 ; WDR25-008; intron 1
OTTHUMT00000414315 ; WDR25-005; intron 1
OTTHUMT00000414316 ; WDR25-006; intron 1
OTTHUMT00000414310 ; WDR25-002; intron 2
OTTHUMT00000414311 ; WDR25-001; intron 2
OTTHUMT00000414312 ; WDR25-004; intron 2
OTTHUMT00000414314 ; WDR25-003; intron 2
ENST00000555775 ; WDR25-007; intron 1
ENST00000554492 ; WDR25-008; intron 1
ENST00000557710 ; WDR25-005; intron 1
ENST00000542471 ; WDR25-006; intron 1
ENST00000554998 ; WDR25-002; intron 2
ENST00000402312 ; WDR25-001; intron 2
ENST00000335290 ; WDR25-004; intron 2
ENST00000554175 ; WDR25-003; intron 2
Clustered miRNAs
< 10kb from hsa-mir-432
hsa-mir-337chr14: 100874493-100874585 [+]
hsa-mir-665chr14: 100875033-100875104 [+]
hsa-mir-431chr14: 100881007-100881120 [+]
hsa-mir-433chr14: 100881886-100881978 [+]
hsa-mir-127chr14: 100882979-100883075 [+]
hsa-mir-432chr14: 100884483-100884576 [+]
hsa-mir-136chr14: 100884702-100884783 [+]
Database links

Mature sequence hsa-miR-432-5p

Accession MIMAT0002814
Previous IDshsa-miR-432
Sequence

14 - 

ucuuggaguaggucauugggugg

 - 36

Get sequence
Deep sequencing28093 reads, 128 experiments
Evidence experimental; array-cloned [1], cloned [2-3]
Database links
Predicted targets

Mature sequence hsa-miR-432-3p

Accession MIMAT0002815
Previous IDshsa-miR-432*
Sequence

62 - 

cuggauggcuccuccaugucu

 - 82

Get sequence
Deep sequencing47 reads, 34 experiments
Evidence experimental; array-cloned [1]
Predicted targets

References

1
PMID:15965474 "Identification of hundreds of conserved and nonconserved human microRNAs" Bentwich I, Avniel A, Karov Y, Aharonov R, Gilad S, Barad O, Barzilai A, Einat P, Einav U, Meiri E, Sharon E, Spector Y, Bentwich Z Nat Genet. 37:766-770(2005).
2
PMID:16274478 "Identification of clustered microRNAs using an ab initio prediction method" Sewer A, Paul N, Landgraf P, Aravin A, Pfeffer S, Brownstein MJ, Tuschl T, van Nimwegen E, Zavolan M BMC Bioinformatics. 6:267(2005).
3
PMID:17604727 "A mammalian microRNA expression atlas based on small RNA library sequencing" Landgraf P, Rusu M, Sheridan R, Sewer A, Iovino N, Aravin A, Pfeffer S, Rice A, Kamphorst AO, Landthaler M, Lin C, Socci ND, Hermida L, Fulci V, Chiaretti S, Foa R, Schliwka J, Fuchs U, Novosel A, Muller RU, Schermer B, Bissels U, Inman J, Phan Q, Chien M Cell. 129:1401-1414(2007).