Stem-loop sequence hsa-mir-493

AccessionMI0003132 (change log)
Symbol HGNC:MIR493
DescriptionHomo sapiens miR-493 stem-loop
Gene family MIPF0000230; mir-493
Literature search

36 open access papers mention hsa-mir-493
(268 sentences)

Stem-loop
        cuc        u                    cauuc  u 
5' cuggc   cagggcuu guacaugguaggcuuucauu     gu u
   |||||   |||||||| ||||||||||||||||||||     ||  
3' gaccg   gucccgga cgugugucaucuggaagugg     ca g
        --u        c                    -cuua  c 
Get sequence
Deep sequencing
11482 reads, 10.1 reads per million, 119 experiments
Confidence Annotation confidence: high
Feedback: Do you believe this miRNA is real?
Comments

The mature miRNA sequences were named miR-493-5p and miR-493-3p in [1,2] and here. Landgraf et al. showed that the 3' product is the predominant one [3]. The mature sequence shown here represents the most commonly cloned form from large-scale cloning studies [3].

Genome context
Coordinates (GRCh38; GCA_000001405.15) Overlapping transcripts
chr14: 100869060-100869148 [+]
sense
OTTHUMT00000414309 ; WDR25-007; intron 1
OTTHUMT00000414313 ; WDR25-008; intron 1
OTTHUMT00000414315 ; WDR25-005; intron 1
OTTHUMT00000414316 ; WDR25-006; intron 1
OTTHUMT00000414310 ; WDR25-002; intron 2
OTTHUMT00000414311 ; WDR25-001; intron 2
OTTHUMT00000414312 ; WDR25-004; intron 2
OTTHUMT00000414314 ; WDR25-003; intron 2
ENST00000555775 ; WDR25-007; intron 1
ENST00000554492 ; WDR25-008; intron 1
ENST00000557710 ; WDR25-005; intron 1
ENST00000542471 ; WDR25-006; intron 1
ENST00000554998 ; WDR25-002; intron 2
ENST00000402312 ; WDR25-001; intron 2
ENST00000335290 ; WDR25-004; intron 2
ENST00000554175 ; WDR25-003; intron 2
Clustered miRNAs
< 10kb from hsa-mir-493
hsa-mir-493chr14: 100869060-100869148 [+]
hsa-mir-337chr14: 100874493-100874585 [+]
hsa-mir-665chr14: 100875033-100875104 [+]
Database links

Mature sequence hsa-miR-493-5p

Accession MIMAT0002813
Previous IDshsa-miR-493;hsa-miR-493-5p;hsa-miR-493*
Sequence

16 - 

uuguacaugguaggcuuucauu

 - 37

Get sequence
Deep sequencing7203 reads, 117 experiments
Evidence experimental; array-cloned [1], cloned [2-3]
Database links
Predicted targets

Mature sequence hsa-miR-493-3p

Accession MIMAT0003161
Previous IDshsa-miR-493-3p;hsa-miR-493
Sequence

57 - 

ugaaggucuacugugugccagg

 - 78

Get sequence
Deep sequencing4277 reads, 116 experiments
Evidence experimental; cloned [2-3]
Database links
Predicted targets

References

1
PMID:15965474 "Identification of hundreds of conserved and nonconserved human microRNAs" Bentwich I, Avniel A, Karov Y, Aharonov R, Gilad S, Barad O, Barzilai A, Einat P, Einav U, Meiri E, Sharon E, Spector Y, Bentwich Z Nat Genet. 37:766-770(2005).
2
PMID:16274478 "Identification of clustered microRNAs using an ab initio prediction method" Sewer A, Paul N, Landgraf P, Aravin A, Pfeffer S, Brownstein MJ, Tuschl T, van Nimwegen E, Zavolan M BMC Bioinformatics. 6:267(2005).
3
PMID:17604727 "A mammalian microRNA expression atlas based on small RNA library sequencing" Landgraf P, Rusu M, Sheridan R, Sewer A, Iovino N, Aravin A, Pfeffer S, Rice A, Kamphorst AO, Landthaler M, Lin C, Socci ND, Hermida L, Fulci V, Chiaretti S, Foa R, Schliwka J, Fuchs U, Novosel A, Muller RU, Schermer B, Bissels U, Inman J, Phan Q, Chien M Cell. 129:1401-1414(2007).