Stem-loop sequence hsa-mir-492

AccessionMI0003131 (change log)
Symbol HGNC:MIR492
DescriptionHomo sapiens miR-492 stem-loop
Gene family MIPF0000499; mir-492
Literature search

15 open access papers mention hsa-mir-492
(24 sentences)

Stem-loop
   caa  a      cuacuacag  c   c ag  c           gau        ccacc 
5'    cu cagcca         ga cau g  ga cugcgggacaa   ucuuggug     a
      || ||||||         || ||| |  || |||||||||||   ||||||||     u
3'    ga gucggu         cu gua c  cu gacguccuguu   aggaccgc     u
   gua  c      ------caa  c   a aa  a           ---        aagag 
Get sequence
Deep sequencing
62 reads, 0 reads per million, 33 experiments
Confidence Annotation confidence: not enough data
Feedback: Do you believe this miRNA is real?
Genome context
Coordinates (GRCh38; GCA_000001405.15) Overlapping transcripts
chr12: 94834398-94834513 [+]
antisense
OTTHUMT00000408147 ; CCDC41-003; intron 1
OTTHUMT00000408146 ; CCDC41-001; intron 1
OTTHUMT00000408148 ; CCDC41-004; intron 1
OTTHUMT00000408149 ; CCDC41-002; intron 1
OTTHUMT00000408213 ; CCDC41-013; intron 1
ENST00000397809 ; CCDC41-003; intron 1
ENST00000339839 ; CCDC41-001; intron 1
ENST00000547232 ; CCDC41-004; intron 1
ENST00000547575 ; CCDC41-002; intron 1
ENST00000546527 ; CCDC41-013; intron 1
ENST00000397807 ; CCDC41-201; intron 1
Database links

Mature sequence hsa-miR-492

Accession MIMAT0002812
Sequence

30 - 

aggaccugcgggacaagauucuu

 - 52

Get sequence
Deep sequencing10 reads, 9 experiments
Evidence experimental; array-cloned [1]
Predicted targets

References

1
PMID:15965474 "Identification of hundreds of conserved and nonconserved human microRNAs" Bentwich I, Avniel A, Karov Y, Aharonov R, Gilad S, Barad O, Barzilai A, Einat P, Einav U, Meiri E, Sharon E, Spector Y, Bentwich Z Nat Genet. 37:766-770(2005).