Stem-loop sequence hsa-mir-202

Accession MI0003130
Symbol HGNC:MIR202
Description Homo sapiens miR-202 stem-loop
Gene family MIPF0000121; mir-202
Stem-loop 
   cuca   cc     -       u           -a           g   au 
cgc    gag  gcccg ccguucc uuuuccuaugc  uauacuucuuu agg  c
|||    |||  ||||| ||||||| |||||||||||  ||||||||||| |||   
gcg    cuc  ugggc ggcgggg aaaaggguacg  auauggagaaa ucc  u
   accc   -c     u       c           gg           -   gg
Get sequence
Deep sequencing
43 reads, 14 experiments
Comments

The mature sequence shown here represents the most commonly cloned form from large-scale cloning studies [2].

Genome context
Coordinates (GRCh37.p5) Overlapping transcripts
chr10: 135061015-135061124 [-]
sense
OTTHUMT00000409805 ; RP13-49I15.5-002; intron 1
OTTHUMT00000409805 ; RP13-49I15.5-002; intron 1
OTTHUMT00000409805 ; RP13-49I15.5-002; intron 1
OTTHUMT00000409806 ; RP13-49I15.5-001; intron 2
OTTHUMT00000409806 ; RP13-49I15.5-001; intron 2
OTTHUMT00000409806 ; RP13-49I15.5-001; intron 2
ENST00000553459 ; RP13-49I15.5-002; intron 1
ENST00000553459 ; RP13-49I15.5-002; intron 1
ENST00000553459 ; RP13-49I15.5-002; intron 1
ENST00000300167 ; RP13-49I15.5-001; intron 2
ENST00000300167 ; RP13-49I15.5-001; intron 2
ENST00000300167 ; RP13-49I15.5-001; intron 2
Database links

Mature sequence hsa-miR-202-5p

Accession MIMAT0002810
Previous IDs hsa-miR-202*
Sequence

28 -  

uuccuaugcauauacuucuuug

 - 49

Get sequence
Deep sequencing 32 reads, 7 experiments
Evidence experimental; array-cloned [1], cloned [2]
Predicted targets

Mature sequence hsa-miR-202-3p

Accession MIMAT0002811
Previous IDs hsa-miR-202
Sequence

64 -  

agagguauagggcaugggaa

 - 83

Get sequence
Deep sequencing 10 reads, 6 experiments
Evidence experimental; cloned [2]
Validated targets
Predicted targets

References

1
PMID:15965474 "Identification of hundreds of conserved and nonconserved human microRNAs" Bentwich I, Avniel A, Karov Y, Aharonov R, Gilad S, Barad O, Barzilai A, Einat P, Einav U, Meiri E, Sharon E, Spector Y, Bentwich Z Nat Genet. 37:766-770(2005).
2
PMID:17604727 "A mammalian microRNA expression atlas based on small RNA library sequencing" Landgraf P, Rusu M, Sheridan R, Sewer A, Iovino N, Aravin A, Pfeffer S, Rice A, Kamphorst AO, Landthaler M, Lin C, Socci ND, Hermida L, Fulci V, Chiaretti S, Foa R, Schliwka J, Fuchs U, Novosel A, Muller RU, Schermer B, Bissels U, Inman J, Phan Q, Chien M Cell. 129:1401-1414(2007).