Stem-loop sequence hsa-mir-146b

AccessionMI0003129 (change log)
Symbol HGNC:MIR146B
DescriptionHomo sapiens miR-146b stem-loop
Gene family MIPF0000103; mir-146
Literature search

387 open access papers mention hsa-mir-146b
(2028 sentences)

Stem-loop
     u      g        au        cu  ga  u 
5' cc ggcacu agaacuga  uccauagg  gu  gc c
   || |||||| ||||||||  ||||||||  ||  ||  
3' gg ccgugg ucuugacu  aggugucc  ua  cg u
     c      -        -c        cg  -a  a 
Get sequence
Deep sequencing
1246949 reads, 2.24e+03 reads per million, 159 experiments
Confidence Annotation confidence: high
Feedback: Do you believe this miRNA is real?
Genome context
Coordinates (GRCh38; GCA_000001405.15) Overlapping transcripts
chr10: 102436512-102436584 [+]
intergenic
Database links

Mature sequence hsa-miR-146b-5p

Accession MIMAT0002809
Previous IDshsa-miR-146b
Sequence

9 - 

ugagaacugaauuccauaggcug

 - 31

Get sequence
Deep sequencing1242970 reads, 159 experiments
Evidence experimental; array-cloned [1], cloned [2]
Database links
Predicted targets

Mature sequence hsa-miR-146b-3p

Accession MIMAT0004766
Sequence

46 - 

gcccuguggacucaguucuggu

 - 67

Get sequence
Deep sequencing3965 reads, 111 experiments
Evidence experimental; cloned [2]
Database links
Predicted targets

References

1
PMID:15965474 "Identification of hundreds of conserved and nonconserved human microRNAs" Bentwich I, Avniel A, Karov Y, Aharonov R, Gilad S, Barad O, Barzilai A, Einat P, Einav U, Meiri E, Sharon E, Spector Y, Bentwich Z Nat Genet. 37:766-770(2005).
2
PMID:17604727 "A mammalian microRNA expression atlas based on small RNA library sequencing" Landgraf P, Rusu M, Sheridan R, Sewer A, Iovino N, Aravin A, Pfeffer S, Rice A, Kamphorst AO, Landthaler M, Lin C, Socci ND, Hermida L, Fulci V, Chiaretti S, Foa R, Schliwka J, Fuchs U, Novosel A, Muller RU, Schermer B, Bissels U, Inman J, Phan Q, Chien M Cell. 129:1401-1414(2007).