Stem-loop sequence hsa-mir-146b

Accession MI0003129
Symbol HGNC:MIR146B
Description Homo sapiens miR-146b stem-loop
Gene family MIPF0000103; mir-146
Community annotation

This text is a summary paragraph taken from the Wikipedia entry entitled miR-146. miRBase and Rfam are facilitating community annotation of microRNA families and entries in Wikipedia. Read more ...

miR-146 is a family of microRNA precursors found in mammals, including humans. The ~22 nucleotide mature miRNA sequence is excised from the precursor hairpin by the enzyme Dicer. This sequence then associates with RISC which effects RNA interference. miR-146 is primarily involved in the regulation of inflammation and other process that function in the innate immune system. Loss of functional miR-146 (and mir-145) could predispose an individual to suffer from chromosome 5q deletion syndrome. miR-146 has also been reported to be highly upregulated in osteoarthritis cartilage, and could be involved in its pathogenesis.

Show Wikipedia entry View @ Wikipedia Edit Wikipedia entry
Stem-loop
  u      g        au        cu  ga  u 
cc ggcacu agaacuga  uccauagg  gu  gc c
|| |||||| ||||||||  ||||||||  ||  ||  
gg ccgugg ucuugacu  aggugucc  ua  cg u
  c      -        -c        cg  -a  a 
Get sequence
Deep sequencing
103220 reads, 28 experiments
Genome context
Coordinates (GRCh37.p5) Overlapping transcripts
chr10: 104196269-104196341 [+]
intergenic
Database links

Mature sequence hsa-miR-146b-5p

Accession MIMAT0002809
Previous IDs hsa-miR-146b
Sequence

9 - 

ugagaacugaauuccauaggcu

 - 30

Get sequence
Deep sequencing 103209 reads, 27 experiments
Evidence experimental; array-cloned [1], cloned [2]
Validated targets
Predicted targets

Mature sequence hsa-miR-146b-3p

Accession MIMAT0004766
Sequence

45 - 

ugcccuguggacucaguucugg

 - 66

Get sequence
Deep sequencing 11 reads, 6 experiments
Evidence experimental; cloned [2]
Validated targets
Predicted targets

References

1
PMID:15965474 "Identification of hundreds of conserved and nonconserved human microRNAs" Bentwich I, Avniel A, Karov Y, Aharonov R, Gilad S, Barad O, Barzilai A, Einat P, Einav U, Meiri E, Sharon E, Spector Y, Bentwich Z Nat Genet. 37:766-770(2005).
2
PMID:17604727 "A mammalian microRNA expression atlas based on small RNA library sequencing" Landgraf P, Rusu M, Sheridan R, Sewer A, Iovino N, Aravin A, Pfeffer S, Rice A, Kamphorst AO, Landthaler M, Lin C, Socci ND, Hermida L, Fulci V, Chiaretti S, Foa R, Schliwka J, Fuchs U, Novosel A, Muller RU, Schermer B, Bissels U, Inman J, Phan Q, Chien M Cell. 129:1401-1414(2007).