Stem-loop sequence hsa-mir-511

AccessionMI0003127 (change log)
Symbol HGNC:MIR511
DescriptionHomo sapiens miR-511 stem-loop
Gene family MIPF0000130; mir-506
Literature search

31 open access papers mention hsa-mir-511
(259 sentences)

Stem-loop
       a   ac    cg           cu   g   g    ua 
5' caau gac  ccau  ugucuuuugcu  gca uca uaaa  u
   |||| |||  ||||  |||||||||||  ||| ||| ||||   
3' guua cug  ggua  acagaaaacga  ugu agu guuu  u
       c   gu    ag           ug   a   -    uu 
Get sequence
Deep sequencing
3115 reads, 0.781 reads per million, 128 experiments
Confidence Annotation confidence: high
Feedback: Do you believe this miRNA is real?
Genome context
Coordinates (GRCh38; GCA_000001405.15) Overlapping transcripts
chr10: 17845107-17845193 [+]
intergenic
Database links

Mature sequence hsa-miR-511-5p

Accession MIMAT0002808
Sequence

16 - 

gugucuuuugcucugcaguca

 - 36

Get sequence
Deep sequencing327 reads, 82 experiments
Evidence experimental; array-cloned [1], Illumina [2]
Predicted targets

Mature sequence hsa-miR-511-3p

Accession MIMAT0026606
Sequence

54 - 

aauguguagcaaaagacaga

 - 73

Get sequence
Deep sequencing2779 reads, 120 experiments
Evidence experimental; Illumina [2]
Database links
Predicted targets

References

1
PMID:15965474 "Identification of hundreds of conserved and nonconserved human microRNAs" Bentwich I, Avniel A, Karov Y, Aharonov R, Gilad S, Barad O, Barzilai A, Einat P, Einav U, Meiri E, Sharon E, Spector Y, Bentwich Z Nat Genet. 37:766-770(2005).
2
PMID:23034410 "Birth and expression evolution of mammalian microRNA genes" Meunier J, Lemoine F, Soumillon M, Liechti A, Weier M, Guschanski K, Hu H, Khaitovich P, Kaessmann H Genome Res. 23:34-45(2013).