Stem-loop sequence hsa-mir-491

AccessionMI0003126 (change log)
Symbol HGNC:MIR491
DescriptionHomo sapiens miR-491 stem-loop
Gene family MIPF0000319; mir-491
Stem-loop
    ug       ug     u      cc   c          a 
5' u  acuuagc  gguag ggggaa  cuu caugaggagu g
   |  |||||||  ||||| ||||||  ||| |||||||||| a
3' g  ugggucg  ccauc ucccuu  gaa guauuccuca a
    gu       gu     u      -a   c          c 
Get sequence
Deep sequencing
3370 reads, 4.92 reads per million, 61 experiments
Confidence Annotation confidence: high
Feedback: Do you believe this miRNA is real?
Comments

The mature sequence shown here represents the most commonly cloned form from large-scale cloning studies [2].

Genome context
Coordinates (GRCh38; GCA_000001405.15) Overlapping transcripts
chr9: 20716105-20716188 [+]
sense
OTTHUMT00000468395 ; FOCAD-008; intron 2
OTTHUMT00000143442 ; FOCAD-001; intron 4
ENST00000338382 ; FOCAD-201; intron 1
ENST00000384877 ; MIR491-201; exon 1
ENST00000604036 ; FOCAD-008; intron 2
ENST00000380249 ; FOCAD-001; intron 4
Database links

Mature sequence hsa-miR-491-5p

Accession MIMAT0002807
Previous IDshsa-miR-491
Sequence

16 - 

aguggggaacccuuccaugagg

 - 37

Get sequence
Deep sequencing3129 reads, 54 experiments
Evidence experimental; array-cloned [1], cloned [2-3]
Database links
Predicted targets

Mature sequence hsa-miR-491-3p

Accession MIMAT0004765
Sequence

50 - 

cuuaugcaagauucccuucuac

 - 71

Get sequence
Deep sequencing240 reads, 40 experiments
Evidence experimental; cloned [2]
Database links
Predicted targets

References

1
PMID:15965474 "Identification of hundreds of conserved and nonconserved human microRNAs" Bentwich I, Avniel A, Karov Y, Aharonov R, Gilad S, Barad O, Barzilai A, Einat P, Einav U, Meiri E, Sharon E, Spector Y, Bentwich Z Nat Genet. 37:766-770(2005).
2
PMID:17604727 "A mammalian microRNA expression atlas based on small RNA library sequencing" Landgraf P, Rusu M, Sheridan R, Sewer A, Iovino N, Aravin A, Pfeffer S, Rice A, Kamphorst AO, Landthaler M, Lin C, Socci ND, Hermida L, Fulci V, Chiaretti S, Foa R, Schliwka J, Fuchs U, Novosel A, Muller RU, Schermer B, Bissels U, Inman J, Phan Q, Chien M Cell. 129:1401-1414(2007).
3
PMID:17616659 "Patterns of known and novel small RNAs in human cervical cancer" Lui WO, Pourmand N, Patterson BK, Fire A Cancer Res. 67:6031-6043(2007).