Stem-loop sequence hsa-mir-490

AccessionMI0003125 (change log)
Symbol HGNC:MIR490
DescriptionHomo sapiens miR-490 stem-loop
Gene family MIPF0000229; mir-490
Stem-loop
   u     -cc      g    -   aguucauu        c      --         g   caa   u 
5'  ggagg   uugcug uuug gaa        guucgaca caugga  ucuccaggu ggu   guu a
    |||||   |||||| |||| |||        |||||||| ||||||  ||||||||| |||   |||  
3'  ccuuc   ggcgac gaac cuu        cgaguugu guaccu  ggaggucca cca   uag g
   a     aca      -    a   ------gu        c      ca         a   -cg   a 
Get sequence
Deep sequencing
41 reads, 0 reads per million, 15 experiments
Confidence Annotation confidence: high
Feedback: Do you believe this miRNA is real?
Genome context
Coordinates (GRCh38; GCA_000001405.15) Overlapping transcripts
chr7: 136903167-136903294 [+]
intergenic
Database links

Mature sequence hsa-miR-490-5p

Accession MIMAT0004764
Sequence

39 - 

ccauggaucuccaggugggu

 - 58

Get sequence
Deep sequencing22 reads, 8 experiments
Evidence experimental; cloned [2-3]
Database links
Predicted targets

Mature sequence hsa-miR-490-3p

Accession MIMAT0002806
Previous IDshsa-miR-490
Sequence

76 - 

caaccuggaggacuccaugcug

 - 97

Get sequence
Deep sequencing13 reads, 9 experiments
Evidence experimental; array-cloned [1]
Database links
Predicted targets

References

1
PMID:15965474 "Identification of hundreds of conserved and nonconserved human microRNAs" Bentwich I, Avniel A, Karov Y, Aharonov R, Gilad S, Barad O, Barzilai A, Einat P, Einav U, Meiri E, Sharon E, Spector Y, Bentwich Z Nat Genet. 37:766-770(2005).
2
PMID:17604727 "A mammalian microRNA expression atlas based on small RNA library sequencing" Landgraf P, Rusu M, Sheridan R, Sewer A, Iovino N, Aravin A, Pfeffer S, Rice A, Kamphorst AO, Landthaler M, Lin C, Socci ND, Hermida L, Fulci V, Chiaretti S, Foa R, Schliwka J, Fuchs U, Novosel A, Muller RU, Schermer B, Bissels U, Inman J, Phan Q, Chien M Cell. 129:1401-1414(2007).
3
PMID:18230126 "New miRNAs cloned from neuroblastoma" Afanasyeva EA, Hotz-Wagenblatt A, Glatting KH, Westermann F BMC Genomics. 9:52(2008).