Stem-loop sequence hsa-mir-489

AccessionMI0003124
Symbol HGNC:MIR489
DescriptionHomo sapiens miR-489 stem-loop
Gene family MIPF0000111; mir-489
Stem-loop
          c     g             c c    ua     a 
5' guggcag uuggu gucguauguguga g cauu  cuuga c
   ||||||| ||||| ||||||||||||| | ||||  |||||  
3' caucguc aaucg cggcauauacacu c guga  ggauu c
          a     a             a a    --     u 
Get sequence
Deep sequencing
78 reads, 72.4 reads per million, 15 experiments
Confidence
Feedback: Do you believe this miRNA is real?
Comments

The mature sequence shown here represents the most commonly cloned form from large-scale cloning studies [2]. The 5' end of the miRNA may be offset with respect to previous annotations.

Genome context
Coordinates (GRCh38) Overlapping transcripts
chr7: 93483936-93484019 [-]
antisense
OTTHUMT00000342070 ; GNGT1-005; intron 1
ENST00000455502 ; GNGT1-005; intron 1
Clustered miRNAs
< 10kb from hsa-mir-489
hsa-mir-489chr7: 93483936-93484019 [-]
hsa-mir-653chr7: 93482760-93482855 [-]
Database links

Mature sequence hsa-miR-489-5p

Accession MIMAT0026605
Sequence

14 - 

ggucguaugugugacgccauuu

 - 35

Get sequence
Deep sequencing1 reads, 1 experiments
Evidence experimental; Illumina [3]

Mature sequence hsa-miR-489-3p

Accession MIMAT0002805
Sequence

52 - 

gugacaucacauauacggcagc

 - 73

Get sequence
Deep sequencing17 reads, 5 experiments
Evidence experimental; array-cloned [1], cloned [2], Illumina [3]
Validated targets
Predicted targets

References

1
PMID:15965474 "Identification of hundreds of conserved and nonconserved human microRNAs" Bentwich I, Avniel A, Karov Y, Aharonov R, Gilad S, Barad O, Barzilai A, Einat P, Einav U, Meiri E, Sharon E, Spector Y, Bentwich Z Nat Genet. 37:766-770(2005).
2
PMID:17604727 "A mammalian microRNA expression atlas based on small RNA library sequencing" Landgraf P, Rusu M, Sheridan R, Sewer A, Iovino N, Aravin A, Pfeffer S, Rice A, Kamphorst AO, Landthaler M, Lin C, Socci ND, Hermida L, Fulci V, Chiaretti S, Foa R, Schliwka J, Fuchs U, Novosel A, Muller RU, Schermer B, Bissels U, Inman J, Phan Q, Chien M Cell. 129:1401-1414(2007).
3
PMID:23034410 "Birth and expression evolution of mammalian microRNA genes" Meunier J, Lemoine F, Soumillon M, Liechti A, Weier M, Guschanski K, Hu H, Khaitovich P, Kaessmann H Genome Res. 23:34-45(2013).