Stem-loop sequence hsa-mir-489

Accession

MI0003124

Symbol

HGNC:MIR489

Description

Homo sapiens miR-489 stem-loop

Gene family

MIPF0000111; mir-489

Stem-loop

       c     g             c c    ua     a 
guggcag uuggu gucguauguguga g cauu  cuuga c
||||||| ||||| ||||||||||||| | ||||  |||||  
caucguc aaucg cggcauauacacu c guga  ggauu c
       a     a             a a    --     u 

Deep sequencing

16 reads, 3 experiments

Comments

The mature sequence shown here represents the most commonly cloned form from large-scale cloning studies [2]. The 5' end of the miRNA may be offset with respect to previous annotations.

Genome context

• Coordinates (GRCh37.p5): chr7: 93113248-93113331 [-]
• Overlapping transcripts:

  sense

  OTTHUMT00000341742 ; CALCR-003; intron 1

  OTTHUMT00000341743 ; CALCR-004; intron 1

  OTTHUMT00000341742 ; CALCR-003; intron 1

  OTTHUMT00000341743 ; CALCR-004; intron 1

  OTTHUMT00000341742 ; CALCR-003; intron 1

  OTTHUMT00000341743 ; CALCR-004; intron 1

  OTTHUMT00000254661 ; CALCR-002; intron 2

  OTTHUMT00000254661 ; CALCR-002; intron 2

  OTTHUMT00000254661 ; CALCR-002; intron 2

  OTTHUMT00000341741 ; CALCR-001; intron 3

  OTTHUMT00000341744 ; CALCR-005; intron 3

  OTTHUMT00000341741 ; CALCR-001; intron 3

  OTTHUMT00000341744 ; CALCR-005; intron 3

  OTTHUMT00000341741 ; CALCR-001; intron 3

  OTTHUMT00000341744 ; CALCR-005; intron 3

  ENST00000423724 ; CALCR-003; intron 1

  ENST00000415529 ; CALCR-004; intron 1

  ENST00000535783 ; CALCR-203; intron 1

  ENST00000423724 ; CALCR-003; intron 1

  ENST00000415529 ; CALCR-004; intron 1

  ENST00000535783 ; CALCR-203; intron 1

  ENST00000423724 ; CALCR-003; intron 1

  ENST00000415529 ; CALCR-004; intron 1

  ENST00000394441 ; CALCR-002; intron 2

  ENST00000394441 ; CALCR-002; intron 2

  ENST00000394441 ; CALCR-002; intron 2

  ENST00000421592 ; CALCR-001; intron 3

  ENST00000426151 ; CALCR-005; intron 3

  ENST00000360249 ; CALCR-202; intron 3

  ENST00000421592 ; CALCR-001; intron 3

  ENST00000426151 ; CALCR-005; intron 3

  ENST00000360249 ; CALCR-202; intron 3

  ENST00000421592 ; CALCR-001; intron 3

  ENST00000426151 ; CALCR-005; intron 3

  ENST00000360249 ; CALCR-202; intron 3

  ENST00000359558 ; CALCR-201; intron 4

  ENST00000359558 ; CALCR-201; intron 4

  ENST00000359558 ; CALCR-201; intron 4

Clustered miRNAs

< 10kb from hsa-mir-489

• hsa-mir-489: chr7: 93113248-93113331 [-]
• hsa-mir-653: chr7: 93112072-93112167 [-]

Database links

• EMBL: AY882328;AY882328
• ENTREZGENE: 574442;MIR489
• HGNC: 32074;MIR489

Mature sequence hsa-miR-489

• Accession: MIMAT0002805
• Sequence: 52 - gugacaucacauauacggcagc - 73
• Deep sequencing: 15 reads, 3 experiments
• Evidence: experimental; array-cloned [1], cloned [2]
• Validated targets:
  • MIRECORDS:hsa-miR-489
  • MIRTARBASE:hsa-miR-489
  • TARBASE:hsa-miR-489
• Predicted targets:
  • DIANA-MICROT:hsa-miR-489
  • MICRORNA.ORG:hsa-miR-489
  • MIRDB:hsa-miR-489
  • RNA22-HSA:hsa-miR-489
  • TARGETMINER:hsa-miR-489
  • TARGETSCAN-VERT:hsa-miR-489

References

1. PMID:15965474 "Identification of hundreds of conserved and nonconserved human microRNAs" Bentwich I, Avniel A, Karov Y, Aharonov R, Gilad S, Barad O, Barzilai A, Einat P, Einav U, Meiri E, Sharon E, Spector Y, Bentwich Z Nat Genet. 37:766-770(2005).
2. PMID:17604727 "A mammalian microRNA expression atlas based on small RNA library sequencing" Landgraf P, Rusu M, Sheridan R, Sewer A, Iovino N, Aravin A, Pfeffer S, Rice A, Kamphorst AO, Landthaler M, Lin C, Socci ND, Hermida L, Fulci V, Chiaretti S, Foa R, Schliwka J, Fuchs U, Novosel A, Muller RU, Schermer B, Bissels U, Inman J, Phan Q, Chien M Cell. 129:1401-1414(2007).