Stem-loop sequence hsa-mir-488

Accession

MI0003123

Symbol

HGNC:MIR488

Description

Homo sapiens miR-488 stem-loop

Gene family

MIPF0000318; mir-488

Stem-loop

    a      cu  c   u      a  c        guu 
gaga ucaucu  cc aga aauggc cu ucaaacaa   u
|||| ||||||  || ||| |||||| || ||||||||   c
cucu aguaga  gg ucu uuaucg ga aguuuguu   c
    c      cu  u   -      -  a        aaa 

Deep sequencing

11 reads, 5 experiments

Comments

miR-488-3p cloned in [2] has a 1 nt 3' extension (U), which is incompatible with the genome sequence.

Genome context

• Coordinates (GRCh37.p5): chr1: 176998499-176998581 [-]
• Overlapping transcripts:

  sense

  OTTHUMT00000084826 ; ASTN1-005; intron 3

  OTTHUMT00000084826 ; ASTN1-005; intron 3

  OTTHUMT00000084826 ; ASTN1-005; intron 3

  OTTHUMT00000084823 ; ASTN1-002; intron 5

  OTTHUMT00000084822 ; ASTN1-001; intron 5

  OTTHUMT00000084825 ; ASTN1-004; intron 5

  OTTHUMT00000084824 ; ASTN1-003; intron 5

  OTTHUMT00000386134 ; ASTN1-006; intron 5

  OTTHUMT00000084823 ; ASTN1-002; intron 5

  OTTHUMT00000084822 ; ASTN1-001; intron 5

  OTTHUMT00000084825 ; ASTN1-004; intron 5

  OTTHUMT00000084824 ; ASTN1-003; intron 5

  OTTHUMT00000386134 ; ASTN1-006; intron 5

  OTTHUMT00000084823 ; ASTN1-002; intron 5

  OTTHUMT00000084822 ; ASTN1-001; intron 5

  OTTHUMT00000084825 ; ASTN1-004; intron 5

  OTTHUMT00000084824 ; ASTN1-003; intron 5

  OTTHUMT00000386134 ; ASTN1-006; intron 5

  ENST00000473640 ; ASTN1-005; intron 3

  ENST00000473640 ; ASTN1-005; intron 3

  ENST00000473640 ; ASTN1-005; intron 3

  ENST00000367657 ; ASTN1-002; intron 5

  ENST00000361833 ; ASTN1-001; intron 5

  ENST00000367654 ; ASTN1-004; intron 5

  ENST00000424564 ; ASTN1-003; intron 5

  ENST00000281881 ; ASTN1-006; intron 5

  ENST00000541808 ; ASTN1-201; intron 5

  ENST00000367657 ; ASTN1-002; intron 5

  ENST00000361833 ; ASTN1-001; intron 5

  ENST00000367654 ; ASTN1-004; intron 5

  ENST00000424564 ; ASTN1-003; intron 5

  ENST00000281881 ; ASTN1-006; intron 5

  ENST00000541808 ; ASTN1-201; intron 5

  ENST00000367657 ; ASTN1-002; intron 5

  ENST00000361833 ; ASTN1-001; intron 5

  ENST00000367654 ; ASTN1-004; intron 5

  ENST00000424564 ; ASTN1-003; intron 5

  ENST00000281881 ; ASTN1-006; intron 5

Database links

• ENTREZGENE: 574441;MIR488
• HGNC: 32073;MIR488

Mature sequence hsa-miR-488-5p

• Accession: MIMAT0002804
• Previous IDs: hsa-miR-488;hsa-miR-488*
• Sequence: 14 - cccagauaauggcacucucaa - 34
• Deep sequencing: 1 reads, 1 experiments
• Evidence: experimental; array-cloned [1]
• Validated targets:
  • TARBASE:hsa-miR-488-5p
• Predicted targets:
  • DIANA-MICROT:hsa-miR-488-5p
  • MICRORNA.ORG:hsa-miR-488-5p
  • MIRDB:hsa-miR-488-5p
  • RNA22-HSA:hsa-miR-488-5p
  • TARGETMINER:hsa-miR-488-5p

Mature sequence hsa-miR-488-3p

• Accession: MIMAT0004763
• Previous IDs: hsa-miR-488
• Sequence: 52 - uugaaaggcuauuucuugguc - 72
• Deep sequencing: 10 reads, 5 experiments
• Evidence: experimental; cloned [2]
• Predicted targets:
  • DIANA-MICROT:hsa-miR-488-3p
  • MICRORNA.ORG:hsa-miR-488-3p
  • MIRDB:hsa-miR-488-3p
  • RNA22-HSA:hsa-miR-488-3p
  • TARGETMINER:hsa-miR-488-3p
  • TARGETSCAN-VERT:hsa-miR-488

References

1. PMID:15965474 "Identification of hundreds of conserved and nonconserved human microRNAs" Bentwich I, Avniel A, Karov Y, Aharonov R, Gilad S, Barad O, Barzilai A, Einat P, Einav U, Meiri E, Sharon E, Spector Y, Bentwich Z Nat Genet. 37:766-770(2005).
2. PMID:17604727 "A mammalian microRNA expression atlas based on small RNA library sequencing" Landgraf P, Rusu M, Sheridan R, Sewer A, Iovino N, Aravin A, Pfeffer S, Rice A, Kamphorst AO, Landthaler M, Lin C, Socci ND, Hermida L, Fulci V, Chiaretti S, Foa R, Schliwka J, Fuchs U, Novosel A, Muller RU, Schermer B, Bissels U, Inman J, Phan Q, Chien M Cell. 129:1401-1414(2007).