Stem-loop sequence sla-mir-106a

AccessionMI0003115 (change log)
DescriptionSaguinus labiatus miR-106a stem-loop
Gene family MIPF0000001; mir-17
Stem-loop
     u   cc      -        a  g     g   c  u 
5' cc ugg  auguaa aagugcuu ca ugcag uag uu u
   || |||  |||||| |||||||| || ||||| ||| || u
3' gg acc  uacauu uucacgaa gu acguc auc ag g
     u   au      c        c  a     -   u  a 
Get sequence
Confidence Annotation confidence: not enough data
Feedback: Do you believe this miRNA is real?
Comments

Berezikov et al. used primers designed from human miRNA gene flanking sequence to amplify miRNA precursor regions in primates [1]. The expression of the mature miRNA was not validated.

Database links

Mature sequence sla-miR-106a

Accession MIMAT0002801
Sequence

13 - 

aaaagugcuuacagugcagguagc

 - 36

Get sequence
Evidence by similarity; MI0000113

References

1
PMID:15652478 "Phylogenetic shadowing and computational identification of human microRNA genes" Berezikov E, Guryev V, van de Belt J, Wienholds E, Plasterk RH, Cuppen E Cell. 120:21-24(2005).