Stem-loop sequence ptr-mir-106a

AccessionMI0003112 (change log)
DescriptionPan troglodytes miR-106a stem-loop
Gene family MIPF0000001; mir-17
Stem-loop
     u   cc      -        a  g     g   c  u 
5' cc ugg  auguaa aagugcuu ca ugcag uag uu u
   || |||  |||||| |||||||| || ||||| ||| || u
3' gg acc  uacauu uucacgaa gu acguc auc ag g
     u   au      c        c  a     -   u  a 
Get sequence
Confidence Annotation confidence: not enough data
Feedback: Do you believe this miRNA is real?
Comments

Berezikov et al. used primers designed from human miRNA gene flanking sequence to amplify miRNA precursor regions in primates [1]. The expression of the mature miRNA was not validated.

Genome context
Coordinates (Pan_tro3.0; GCA_000001515.5) Overlapping transcripts
chrX: 134038418-134038498 [-]
intergenic
Clustered miRNAs
< 10kb from ptr-mir-106a
ptr-mir-106achrX: 134038418-134038498 [-]
ptr-mir-18bchrX: 134038262-134038331 [-]
ptr-mir-20bchrX: 134038030-134038097 [-]
ptr-mir-19b-2chrX: 134037891-134037987 [-]
ptr-mir-92-2chrX: 134037758-134037832 [-]
Database links

Mature sequence ptr-miR-106a

Accession MIMAT0002800
Sequence

13 - 

aaaagugcuuacagugcagguagc

 - 36

Get sequence
Evidence by similarity; MI0000113
Predicted targets

References

1
PMID:15652478 "Phylogenetic shadowing and computational identification of human microRNA genes" Berezikov E, Guryev V, van de Belt J, Wienholds E, Plasterk RH, Cuppen E Cell. 120:21-24(2005).