Stem-loop sequence ggo-mir-92-2

AccessionMI0003098 (change log)
DescriptionGorilla gorilla miR-92-2 stem-loop
Gene family MIPF0000013; mir-25
Stem-loop
     a   c     g     uu  u   u     -      
5' uc ucc ugggu gggau  gu gca uacuu guguu 
   || ||| ||||| |||||  || ||| ||||| |||| c
3' ag agg guccg cccug  ca cgu augaa uauau 
     a   u     g     uu  -   u     a      
Get sequence
Confidence Annotation confidence: not enough data
Feedback: Do you believe this miRNA is real?
Comments

Berezikov et al. used primers designed from human miRNA gene flanking sequence to amplify miRNA precursor regions in primates [1]. The expression of the mature miRNA was not validated.

Genome context
Coordinates (GorGor4; GCA_000151905.3) Overlapping transcripts
chrX: 134207488-134207562 [-]
intergenic
Clustered miRNAs
< 10kb from ggo-mir-92-2
ggo-mir-106achrX: 134208148-134208228 [-]
ggo-mir-18bchrX: 134207967-134208075 [-]
ggo-mir-20bchrX: 134207730-134207842 [-]
ggo-mir-19b-2chrX: 134207621-134207716 [-]
ggo-mir-92-2chrX: 134207488-134207562 [-]
ggo-mir-363chrX: 134207311-134207423 [-]
Database links

Mature sequence ggo-miR-92

Accession MIMAT0002664
Sequence

48 - 

uauugcacuugucccggccugu

 - 69

Get sequence
Evidence by similarity; MI0000094

References

1
PMID:15652478 "Phylogenetic shadowing and computational identification of human microRNA genes" Berezikov E, Guryev V, van de Belt J, Wienholds E, Plasterk RH, Cuppen E Cell. 120:21-24(2005).