Stem-loop sequence ggo-mir-19b-2

AccessionMI0003097 (change log)
DescriptionGorilla gorilla miR-19b-2 stem-loop
Gene family MIPF0000011; mir-19
Stem-loop
         cuac                 -  -       uuca       u 
5' acauug    uuacaauuaguuuugca gg uuugcau    gcguaua a
   ||||||    ||||||||||||||||| || |||||||    |||||||  
3' uguaau    aguguuagucaaaacgu cc aaacgug    uguauau u
         ----                 a  u       ucgg       g 
Get sequence
Confidence Annotation confidence: not enough data
Feedback: Do you believe this miRNA is real?
Comments

Berezikov et al. used primers designed from human miRNA gene flanking sequence to amplify miRNA precursor regions in primates [1]. The expression of the mature miRNA was not validated.

Genome context
Coordinates (GorGor4; GCA_000151905.3) Overlapping transcripts
chrX: 134207621-134207716 [-]
sense
ENSGGOT00000040260 ; ggo-mir-19b-2-201; exon 1
Clustered miRNAs
< 10kb from ggo-mir-19b-2
ggo-mir-106achrX: 134208148-134208228 [-]
ggo-mir-18bchrX: 134207967-134208075 [-]
ggo-mir-20bchrX: 134207730-134207842 [-]
ggo-mir-19b-2chrX: 134207621-134207716 [-]
ggo-mir-92-2chrX: 134207488-134207562 [-]
ggo-mir-363chrX: 134207311-134207423 [-]
Database links

Mature sequence ggo-miR-19b

Accession MIMAT0002663
Sequence

62 - 

ugugcaaauccaugcaaaacuga

 - 84

Get sequence
Evidence by similarity; MI0000075

References

1
PMID:15652478 "Phylogenetic shadowing and computational identification of human microRNA genes" Berezikov E, Guryev V, van de Belt J, Wienholds E, Plasterk RH, Cuppen E Cell. 120:21-24(2005).