Stem-loop sequence ggo-mir-106a

AccessionMI0003096 (change log)
DescriptionGorilla gorilla miR-106a stem-loop
Gene family MIPF0000001; mir-17
Stem-loop
     u   cc      -        a  g     g   c  u 
5' cc ugg  auguaa aagugcuu ca ugcag uag uu u
   || |||  |||||| |||||||| || ||||| ||| || u
3' gg acc  uacauu uucacgaa gu acguc auc ag g
     u   au      c        c  a     -   u  a 
Get sequence
Confidence Annotation confidence: not enough data
Feedback: Do you believe this miRNA is real?
Comments

Berezikov et al. used primers designed from human miRNA gene flanking sequence to amplify miRNA precursor regions in primates [1]. The expression of the mature miRNA was not validated.

Genome context
Coordinates (GorGor4; GCA_000151905.3) Overlapping transcripts
chrX: 134208148-134208228 [-]
intergenic
Clustered miRNAs
< 10kb from ggo-mir-106a
ggo-mir-106achrX: 134208148-134208228 [-]
ggo-mir-18bchrX: 134207967-134208075 [-]
ggo-mir-20bchrX: 134207730-134207842 [-]
ggo-mir-19b-2chrX: 134207621-134207716 [-]
ggo-mir-92-2chrX: 134207488-134207562 [-]
ggo-mir-363chrX: 134207311-134207423 [-]
Database links

Mature sequence ggo-miR-106a

Accession MIMAT0002795
Sequence

13 - 

aaaagugcuuacagugcagguagc

 - 36

Get sequence
Evidence by similarity; MI0000113

References

1
PMID:15652478 "Phylogenetic shadowing and computational identification of human microRNA genes" Berezikov E, Guryev V, van de Belt J, Wienholds E, Plasterk RH, Cuppen E Cell. 120:21-24(2005).