Stem-loop sequence mml-mir-183

AccessionMI0003084 (change log)
DescriptionMacaca mulatta miR-183 stem-loop
Gene family MIPF0000066; mir-183
Literature search

1 open access papers mention mml-mir-183
(3 sentences)

Stem-loop
   ccgcagaa    ac  -----         g      --ac     ga        --   ac 
5'         cgug  uc     cuguucugu uauggc    uggua  auucacug  uga  a
           ||||  ||     ||||||||| ||||||    |||||  ||||||||  |||   
3'         gcac  ag     gacgagaca auaccg    gccau  uaagugac  gcu  g
   -------a    cu  acaga         a      ggaa     --        ug   cu 
Get sequence
Deep sequencing
51775 reads, 244 reads per million, 9 experiments
Confidence Annotation confidence: high
Feedback: Do you believe this miRNA is real?
Comments

Berezikov et al. used primers designed from human miRNA gene flanking sequence to amplify miRNA precursor regions in primates [1]. The expression of the mature miRNA was not validated.

Genome context
Coordinates (Mmul_8.0.1; GCA_000772875.3) Overlapping transcripts
chr3: 155860330-155860439 [-]
intergenic
Clustered miRNAs
< 10kb from mml-mir-183
mml-mir-183chr3: 155860330-155860439 [-]
mml-mir-96chr3: 155860126-155860203 [-]
mml-mir-182chr3: 155854815-155854926 [-]
Database links

Mature sequence mml-miR-183-5p

Accession MIMAT0002783
Sequence

27 - 

uauggcacugguagaauucacug

 - 49

Get sequence
Deep sequencing51731 reads, 9 experiments
Evidence experimental; Illumina [2]
Database links
Predicted targets

Mature sequence mml-miR-183-3p

Accession MIMAT0026603
Sequence

66 - 

gugaauuaccgaagggccauaaa

 - 88

Get sequence
Deep sequencing44 reads, 4 experiments
Evidence experimental; Illumina [2]
Predicted targets

References

1
PMID:15652478 "Phylogenetic shadowing and computational identification of human microRNA genes" Berezikov E, Guryev V, van de Belt J, Wienholds E, Plasterk RH, Cuppen E Cell. 120:21-24(2005).
2
PMID:23034410 "Birth and expression evolution of mammalian microRNA genes" Meunier J, Lemoine F, Soumillon M, Liechti A, Weier M, Guschanski K, Hu H, Khaitovich P, Kaessmann H Genome Res. 23:34-45(2013).