Stem-loop sequence mne-mir-93

AccessionMI0003082 (change log)
DescriptionMacaca nemestrina miR-93 stem-loop
Gene family MIPF0000001; mir-17
Stem-loop
             -ca       -     u    g   ug  au 
5' cugggggcuc   aagugcu guucg gcag uag  ug  u
   ||||||||||   ||||||| ||||| |||| |||  ||   
3' gacccccgag   uucacga cgagu cguc auc  gc  a
             ccc       u     -    -   ca  ca 
Get sequence
Confidence Annotation confidence: not enough data
Feedback: Do you believe this miRNA is real?
Comments

Berezikov et al. used primers designed from human miRNA gene flanking sequence to amplify miRNA precursor regions in primates [1]. The expression of the mature miRNA was not validated.

Database links

Mature sequence mne-miR-93

Accession MIMAT0002781
Sequence

12 - 

aaagugcuguucgugcagguag

 - 33

Get sequence
Evidence by similarity; MI0000095

References

1
PMID:15652478 "Phylogenetic shadowing and computational identification of human microRNA genes" Berezikov E, Guryev V, van de Belt J, Wienholds E, Plasterk RH, Cuppen E Cell. 120:21-24(2005).