Stem-loop sequence lla-mir-106b

AccessionMI0003078 (change log)
DescriptionLagothrix lagotricha miR-106b stem-loop
Gene family MIPF0000001; mir-17
Stem-loop
        c     -ua       g       a a   ug cc 
5' ccugc ggggc   aagugcu acagugc g uag  u  u
   ||||| |||||   ||||||| ||||||| | |||  |  c
3' ggacg ccucg   uucaugg ugucacg c auc  g  u
        a     ucg       g       c -   gu cc 
Get sequence
Confidence Annotation confidence: not enough data
Feedback: Do you believe this miRNA is real?
Comments

Berezikov et al. used primers designed from human miRNA gene flanking sequence to amplify miRNA precursor regions in primates [1]. The expression of the mature miRNA was not validated.

Database links

Mature sequence lla-miR-106b

Accession MIMAT0002777
Sequence

12 - 

uaaagugcugacagugcagau

 - 32

Get sequence
Evidence by similarity; MI0000734

References

1
PMID:15652478 "Phylogenetic shadowing and computational identification of human microRNA genes" Berezikov E, Guryev V, van de Belt J, Wienholds E, Plasterk RH, Cuppen E Cell. 120:21-24(2005).