Stem-loop sequence mml-mir-93

AccessionMI0003074 (change log)
DescriptionMacaca mulatta miR-93 stem-loop
Gene family MIPF0000001; mir-17
Literature search

3 open access papers mention mml-mir-93
(3 sentences)

Stem-loop
             -ca       -     u    g   ug  au 
5' cugggggcuc   aagugcu guucg gcag uag  ug  u
   ||||||||||   ||||||| ||||| |||| |||  ||   
3' gacccccgag   uucacga cgagu cguc auc  gc  a
             ccc       u     -    -   ca  ca 
Get sequence
Deep sequencing
186208 reads, 1.72e+03 reads per million, 9 experiments
Confidence Annotation confidence: high
Feedback: Do you believe this miRNA is real?
Comments

Berezikov et al. used primers designed from human miRNA gene flanking sequence to amplify miRNA precursor regions in primates [1]. The expression of the mature miRNA was not validated.

Genome context
Coordinates (Mmul_8.0.1; GCA_000772875.3) Overlapping transcripts
chr3: 125615179-125615258 [-]
intergenic
Clustered miRNAs
< 10kb from mml-mir-93
mml-mir-106bchr3: 125615402-125615483 [-]
mml-mir-93chr3: 125615179-125615258 [-]
mml-mir-25chr3: 125614974-125615057 [-]
Database links

Mature sequence mml-miR-93-5p

Accession MIMAT0002773
Sequence

12 - 

aaagugcuguucgugcagguag

 - 33

Get sequence
Deep sequencing185945 reads, 9 experiments
Evidence experimental; Illumina [2]
Database links
Predicted targets

Mature sequence mml-miR-93-3p

Accession MIMAT0026602
Sequence

50 - 

acugcugagcuagcacuucccg

 - 71

Get sequence
Deep sequencing259 reads, 9 experiments
Evidence experimental; Illumina [2]
Predicted targets

References

1
PMID:15652478 "Phylogenetic shadowing and computational identification of human microRNA genes" Berezikov E, Guryev V, van de Belt J, Wienholds E, Plasterk RH, Cuppen E Cell. 120:21-24(2005).
2
PMID:23034410 "Birth and expression evolution of mammalian microRNA genes" Meunier J, Lemoine F, Soumillon M, Liechti A, Weier M, Guschanski K, Hu H, Khaitovich P, Kaessmann H Genome Res. 23:34-45(2013).