Stem-loop sequence mml-mir-106b

AccessionMI0003073 (change log)
DescriptionMacaca mulatta miR-106b stem-loop
Gene family MIPF0000001; mir-17
Literature search

1 open access papers mention mml-mir-106b
(1 sentences)

Stem-loop
              -ua       g       a a    --  uc 
5' ccugcuggggc   aagugcu acagugc g uagu  gg  c
   |||||||||||   ||||||| ||||||| | ||||  ||   
3' ggacgaccucg   uucaugg ugucacg c aucg  cc  u
              ucg       g       c -    ug  uc 
Get sequence
Deep sequencing
69818 reads, 356 reads per million, 9 experiments
Confidence Annotation confidence: high
Feedback: Do you believe this miRNA is real?
Comments

Berezikov et al. used primers designed from human miRNA gene flanking sequence to amplify miRNA precursor regions in primates [1]. The expression of the mature miRNA was not validated.

Genome context
Coordinates (Mmul_8.0.1; GCA_000772875.3) Overlapping transcripts
chr3: 125615402-125615483 [-]
intergenic
Clustered miRNAs
< 10kb from mml-mir-106b
mml-mir-106bchr3: 125615402-125615483 [-]
mml-mir-93chr3: 125615179-125615258 [-]
mml-mir-25chr3: 125614974-125615057 [-]
Database links

Mature sequence mml-miR-106b-5p

Accession MIMAT0002772
Sequence

12 - 

uaaagugcugacagugcagau

 - 32

Get sequence
Deep sequencing62112 reads, 9 experiments
Evidence experimental; Illumina [2]
Database links
Predicted targets

Mature sequence mml-miR-106b-3p

Accession MIMAT0026601
Sequence

51 - 

accgcacuguggguacuugcug

 - 72

Get sequence
Deep sequencing7701 reads, 9 experiments
Evidence experimental; Illumina [2]
Predicted targets

References

1
PMID:15652478 "Phylogenetic shadowing and computational identification of human microRNA genes" Berezikov E, Guryev V, van de Belt J, Wienholds E, Plasterk RH, Cuppen E Cell. 120:21-24(2005).
2
PMID:23034410 "Birth and expression evolution of mammalian microRNA genes" Meunier J, Lemoine F, Soumillon M, Liechti A, Weier M, Guschanski K, Hu H, Khaitovich P, Kaessmann H Genome Res. 23:34-45(2013).