Stem-loop sequence ppy-mir-106b

AccessionMI0003067 (change log)
DescriptionPongo pygmaeus miR-106b stem-loop
Gene family MIPF0000001; mir-17
Stem-loop
        c     -ua       g       a a    --  uc 
5' ccugc ggggc   aagugcu acagugc g uagu  gg  c
   ||||| |||||   ||||||| ||||||| | ||||  ||   
3' ggacg ccucg   uucaugg ugucacg c aucg  cc  u
        a     ucg       g       c -    ug  uc 
Get sequence
Confidence Annotation confidence: not enough data
Feedback: Do you believe this miRNA is real?
Comments

Berezikov et al. used primers designed from human miRNA gene flanking sequence to amplify miRNA precursor regions in primates [1]. The expression of the mature miRNA was not validated.

Genome context
Coordinates (P_pygmaeus_2.0.2; GCF_000001545.4) Overlapping transcripts
chr7: 9079286-9079367 [-]
intergenic
Clustered miRNAs
< 10kb from ppy-mir-106b
ppy-mir-106bchr7: 9079286-9079367 [-]
ppy-mir-93chr7: 9079061-9079140 [-]
ppy-mir-25chr7: 9078853-9078936 [-]
Database links

Mature sequence ppy-miR-106b

Accession MIMAT0002766
Sequence

12 - 

uaaagugcugacagugcagau

 - 32

Get sequence
Evidence by similarity; MI0000734

References

1
PMID:15652478 "Phylogenetic shadowing and computational identification of human microRNA genes" Berezikov E, Guryev V, van de Belt J, Wienholds E, Plasterk RH, Cuppen E Cell. 120:21-24(2005).