Stem-loop sequence mml-mir-27a

AccessionMI0003052 (change log)
DescriptionMacaca mulatta miR-27a stem-loop
Gene family MIPF0000036; mir-27
Literature search

1 open access papers mention mml-mir-27a
(2 sentences)

Stem-loop
      a  a  a         ug  u       g  u cac 
5' cug gg gc gggcuuagc  cu gugagca gg c   a
   ||| || || |||||||||  || ||||||| || |    
3' gac cc cg cuugaaucg  ga cacuugu cu g   c
      c  c  c         gu  -       g  - aac 
Get sequence
Deep sequencing
867239 reads, 5.08e+03 reads per million, 9 experiments
Confidence Annotation confidence: high
Feedback: Do you believe this miRNA is real?
Comments

Berezikov et al. used primers designed from human miRNA gene flanking sequence to amplify miRNA precursor regions in primates [1]. The expression of the mature miRNA was not validated.

Genome context
Coordinates (Mmul_8.0.1; GCA_000772875.3) Overlapping transcripts
chr19: 13839013-13839090 [-]
antisense
ENSMMUT00000019009 ; IL27RA-201; 3'UTR (exon 10)
Clustered miRNAs
< 10kb from mml-mir-27a
mml-mir-23achr19: 13839158-13839230 [-]
mml-mir-27achr19: 13839013-13839090 [-]
mml-mir-24-2chr19: 13838860-13838932 [-]
Database links

Mature sequence mml-miR-27a-5p

Accession MIMAT0026600
Sequence

10 - 

agggcuuagcugcuugugagca

 - 31

Get sequence
Deep sequencing925 reads, 9 experiments
Evidence experimental; Illumina [2]
Predicted targets

Mature sequence mml-miR-27a-3p

Accession MIMAT0002753
Sequence

51 - 

uucacaguggcuaaguuccgcc

 - 72

Get sequence
Deep sequencing866303 reads, 9 experiments
Evidence experimental; Illumina [2]
Database links
Predicted targets

References

1
PMID:15652478 "Phylogenetic shadowing and computational identification of human microRNA genes" Berezikov E, Guryev V, van de Belt J, Wienholds E, Plasterk RH, Cuppen E Cell. 120:21-24(2005).
2
PMID:23034410 "Birth and expression evolution of mammalian microRNA genes" Meunier J, Lemoine F, Soumillon M, Liechti A, Weier M, Guschanski K, Hu H, Khaitovich P, Kaessmann H Genome Res. 23:34-45(2013).