Stem-loop sequence mne-mir-194

AccessionMI0003032 (change log)
DescriptionMacaca nemestrina miR-194 stem-loop
Gene family MIPF0000055; mir-194
Stem-loop
   a    - uu      u         a      g    cu  gu 
5'  uggu g  aucaag guaacagca cuccau ugga  gu  a
    |||| |  |||||| ||||||||| |||||| ||||  ||   
3'  acca u  uaguuu cauugucgu gaggug accu  ua  c
   a    u gg      u         a      -    -u  ac 
Get sequence
Confidence Annotation confidence: not enough data
Feedback: Do you believe this miRNA is real?
Comments

Berezikov et al. used primers designed from human miRNA gene flanking sequence to amplify miRNA precursor regions in primates [1]. The expression of the mature miRNA was not validated.

Database links

Mature sequence mne-miR-194

Accession MIMAT0002735
Sequence

15 - 

uguaacagcaacuccaugugga

 - 36

Get sequence
Evidence by similarity; MI0000488

References

1
PMID:15652478 "Phylogenetic shadowing and computational identification of human microRNA genes" Berezikov E, Guryev V, van de Belt J, Wienholds E, Plasterk RH, Cuppen E Cell. 120:21-24(2005).