Stem-loop sequence mml-mir-215

AccessionMI0003025 (change log)
DescriptionMacaca mulatta miR-215 stem-loop
Gene family MIPF0000063; mir-192
Literature search

2 open access papers mention mml-mir-215
(2 sentences)

Stem-loop
   aucauuaa   a      ------      a a  a    -u   u         cu  ag 
5'         gaa ugguau      acagga a ug ccua  gaa ugacagaca  au  c
           ||| ||||||      |||||| | || ||||  ||| |||||||||  ||   
3'         cuu aucgug      ugucuu u ac ggau  cuu acugucugu  ug  u
   ------aa   c      ucagua      a a  c    uu   u         -u  ag 
Get sequence
Deep sequencing
1256499 reads, 8.44e+03 reads per million, 9 experiments
Confidence Annotation confidence: not enough data
Feedback: Do you believe this miRNA is real?
Comments

Berezikov et al. used primers designed from human miRNA gene flanking sequence to amplify miRNA precursor regions in primates [1]. The expression of the mature miRNA was not validated.

Genome context
Coordinates (Mmul_8.0.1; GCA_000772875.3) Overlapping transcripts
chr1: 146241256-146241365 [+]
intergenic
Clustered miRNAs
< 10kb from mml-mir-215
mml-mir-194-1chr1: 146240974-146241058 [+]
mml-mir-215chr1: 146241256-146241365 [+]
Database links

Mature sequence mml-miR-215-5p

Accession MIMAT0002728
Sequence

27 - 

augaccuaugaauugacagac

 - 47

Get sequence
Deep sequencing1256484 reads, 9 experiments
Evidence experimental; Illumina [2]
Database links
Predicted targets

Mature sequence mml-miR-215-3p

Accession MIMAT0026598
Sequence

64 - 

ucugucauuucuuuaggccaaua

 - 86

Get sequence
Deep sequencing14 reads, 1 experiments
Evidence experimental; Illumina [2]
Predicted targets

References

1
PMID:15652478 "Phylogenetic shadowing and computational identification of human microRNA genes" Berezikov E, Guryev V, van de Belt J, Wienholds E, Plasterk RH, Cuppen E Cell. 120:21-24(2005).
2
PMID:23034410 "Birth and expression evolution of mammalian microRNA genes" Meunier J, Lemoine F, Soumillon M, Liechti A, Weier M, Guschanski K, Hu H, Khaitovich P, Kaessmann H Genome Res. 23:34-45(2013).